ࡱ>  Root EntryP!FileType Contents_ SummaryInformation(i !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~Root EntryЁ!FileType ContentsSummaryInformation(iOh+'Oh+'09  ,63@Phz:@@Ё!@pT3 PCBArtistPCB Design       !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~2RMM CAreaArrayCArea CLineStyleOutlines CDesignShape CShapeSegment^, ^|( |( ,  CLayer Top Copper CLayerType ElectricalCNet1GNDCConnectionArray CConnectionCNode CPadInstanceCSymbolInstanceCComponentInstance CComponent CPcbComponent2!CAttributeArray# CAttribute#CAttributeName Manufacturer&#(Manufacturer Part Number&#( Distributor&#(Distributor Part NumberCAttributeNameArray)+-/(N(V(Value(TOL(MfrSMSM0402 CGateMapArray#CGateMap# CGatePinArray:CGatePin:11=:22+uLKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl CScmComponent2 C 100N 0402 CGateArrayACGateACMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslCC1121CSymbolInstanceArray (CSymbol2SM0402CFreeCopperArray CFreeCopperI LineStyle8M p.LpL $TLpL $TLL p.LLPOOOOQRSTop Silkscreen Silk Screen@@@@@@@@@ CFreePadArrayCFreePadIJAL'L CPadStyle PadStyle137"[Top]CValuePositionArrayYCValuePositionY CTextStyle [Pin Names]1_LEL _Ya [Pin Numbers]1LK@XIJALZL[\]e_eb_L[xL _edLZL@]I_IaStyle11LLTJALJAL v?8c8cCCopperInstanceArrayCCopperInstanceMCPadInstanceArray1VDDttt "2{$|&|)&|+&|-&|/1SMSM04027|9|;=11=22LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 L 102 0402BDLMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslLL11Fzy&$IlynyMpyy13V3 "2$&)&+&-&/1SM TESTTERM2.079;=11LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 TestPointBDTESTPTNC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Testpoint.sslTPTP8F##H2 TESTTERM2.0JLN PLPL  PLZL TVXPLLZStyle46@[All]]_bLxL _dV9ML@]_kLPLTPLLL8c8clnp]_k2Tj#T]_bl# _d)m$$@##CTrack CTrackSegments$sX$## CTrackStyleÀÀÀ "2$&)&+&-&/1SMSM060379;=11=22LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 C 4U7 0603BDCMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslCC12F~%%H2SM0603JLN &LO~L [LO~L [LEL &LELTVXJALLZ PadStyle138'*\]_b_LT%@]_k3!%_T]_bB % _dF$@~%s$s%~%VVVÀStyle2pXY$_&_)&_+&_-&_/1 "2e$f&f)&f+&f-&f/1USERTPS769337f9f;m=m11=m22=m33=m44=m55+LD(ds(e'Me'e'4(|o(ds( Bottom Copper$&)&+&-&/1 "2$&)&+&-&/1QFNcc1111379;$=11=22=33=44=55=66=77=88=99=1010=1111=1212=1313=1414=1515=1616=1717=1818=1919=2020=2121=2222=2323=2424=2525=2626=2727=2828=2929=3030=3131=3232=3333=3434=3535=3636cMQC:\Documents and Settings\All Users\Documents\PCB Artist\Library\chip layouts.psl@2CC1111B D CC1111$P1_2DVDDP1_1P1_0P0_0PO_1P0_2P0_3P0_4DPDMDVDDP0_5P2_0P2_1P2_2P2_3P2_4AVDDXOSC_Q2XOSC_Q1AVDDRF_PRF_NAVDDAVDDR_BIASGUARD AVDD_DREGDCOUPLRESET_NP1_7P1_6P1_5P1_4P1_3HC:\Documents and Settings\All Users\Documents\PCB Artist\Library\MSD.sslUU11Fx)H2cc11113VX &&ZPS1_5%\]_d&)&@_b&% X &&\]_d&)&@_b&% X &&\]_d&)&@_b&% X '&\]_d')&@_b'% X %'&\] _ d%')&@_ b%'% X 8'&\]$_$d8')&@_$b8'% X (L'&\](_(d(L')&@_(b(L'% X _'&\],_,d_')&@_,b_'% X 8s'&\]0_0d8s')&@_0b8s'%  X r'&_\]4_4d'&@_4b(&  X r'&_\]8_8d'&@_8b(&  X r'&_\]<_<d'&@_<b(&  X r''_\]@_@d''@_@b('  X r'%'_\]D_Dd'%'@_Db(%' X r'8'_\]H_Hd'8'@_Hb(8' X r'(L'_\]L_Ld'(L'@_Lb((L' X r'_'_\]P_Pd'_'@_Pb(_' X r'8s'_\]T_Td'8s'@_Tb(8s' X 8s'r' \]X_Xd8s'a'@_Xb8s'' X _'r' \]\_\d_'a'@_\b_'' X (L'r' \]`_`d(L'a'@_`b(L'' X 8'r' \]d_dd8'a'@_db8'' X %'r' \]h_hd%'a'@_hb%'' X 'r' \]l_ld'a'@_lb'' X &r' \]p_pd&a'@_pb&' X &r' \]t_td&a'@_tb&' X &r' \]x_xd&a'@_xb&' X &8s'\]|_|dV@&8s'@_|b+ &8s' X &_'\]_dV@&_'@_b+ &_' X &(L'\]_dV@&(L'@_b+ &(L' X &8'\]_dV@&8'@_b+ &8' X &%'\]_dV@&%'@_b+ &%'  X &'\]_dV@&'@_b+ &' !X &&\]_dV@&&@_b+ && "X &&\]_dV@&&@_b+ && #X &&\]_dV@&&@_b+ && $X &E'ZStyle4_1@\]_d&'@_b&p' %X '%'ZStyle2_2@\]_d')'@_b'' &X H'$'\]_dH''@_bH'<' 'X %'E'\]_d%''@_b%'' (X l'E'\]_dl' '@_bl'f' )X ~&R&\]_d~&w^'@_b~&Ё' *X "%'&\]_d"%'^'@_b"%'v' +X l'H&\]_dl'm^'@_bl'Ɓ' ,-] _ x&'T'V'rM8c8cpN0484 "2$&)&+&-&/1USERMICRO SW79;=11=22=33=44.LHC:\Documents and Settings\All Users\Documents\PCB Artist\Library\MSD.psl@2MICRO SWBDMICRO SWHC:\Documents and Settings\All Users\Documents\PCB Artist\Library\MSD.sslSWSW11Ft/%H2MICRO SWJL{ Ĝ& X( Ė' X( Ė'& Ĝ&& Ĝ&d' j&d' j&B' Ĝ&B'TL{ &a( 'a( 'T& &T&VX&&ZPS1_36R\]_d&3&@_b&& Xq'&\]_dq'3&@_bq'& Xq'X%( \]_dq'sp(@_bq'U( X&X%( \]_d&sp(@_b&U( ]_&N(T's'-L8c8clnnp o0%] _ do5o& @_ bo&  20%]_d25o& @_b2&  o}$]_do2$ @_bo$  ]_#T ]_d22$ @_b2$  2}$2}$20% "fd&M"fd&!fd&!d&20%$$$&')UlH(M)UlH(((|h(*kh(ULw(UlH(++++-./)"0UlH(U(fd&11134G)"J(|h(]_d(|W(@_b(|( t9h(]9_9d6h(@_9bh( ]>_>d/h(@_>bh(  ]B_BdVh(@_Bb&#h( N0510HHH "2O$P&P)&P+&P-&P/1USERRES_NETW_PANASONIC7P9P;W=W11=W22=W33=W44=W55=W66=W77=W88LLC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF11207.psl@2 RES 820 NETWBaDaRES_NETW_PANASONICLC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF11207.sslRNRN13FNM>5[(H2RES_NETW_PANASONICJLe{g & ' (3' ' (3'j& &j& &h& @&h& @&& &&ihhhhhhhhjklmnopTLe{q &' :'' :'& &&srrrrtuvVXe&&ZRNET_F1@\]x_xd&:9&@_xb&% Xe &&y\]}_}d &:9&@_}b &% Xe`'&y\]_d`':9&@_b`'% Xe'&y\]_d':9&@_b'% Xe'&y \]_d'>'@_b'H' Xe`'&y \]_d`'>'@_b`'H' Xe &&y \]_d &>'@_b &H' Xe&&y \]_d&>'@_b&H'  ]e_e&-'T0'&,L8c8clMnMgnMqpMMN0497$1 "2$&)&+&-&/1SM ChipLEDnew79;=11=22VLHC:\Documents and Settings\All Users\Documents\PCB Artist\Library\MSD.psl@2LED SMDBDLEDMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslLEDLED11F~N&H2 ChipLEDnewJL{ &,& H^',& H^'& &&TL{ &@{& 4h'@{& 4h'' &'VX&&ZPS1_4:e\]_d=1&&@_b%& X7'&\]_d!'&@_b'& ]_&R'Tx&&BVL8c8clnnp&]_do&@_b& ]_s&T]_d&@_bv"& &fX'.'&m'&&&GJfX'x]_d '_@_b>!'_ MN0498$1LED12F~N'lnnp']_do'@_b' ]_L'T]_d'@_bv"' 'fX''L}'a'' GJfX'}]_d '_@_b>!'_ MN0499$1LED13F~ND'lnnpD']_doD'@_bD' ]_'T]_dD'@_bv"D' D'fX$'$'D'''')*GJfX$']_d $'_@_b>!$'_ MN05001101$71LED14F76~N4(l6n6n6p656>4(]>_>do4(@_>b4( ]6_6(T4]5_5d4(@_5bv"4( 4(3fXd'fd'4(HHHJKG104J/fXd']/_/d d'_@_/b>!d'_ MN0509RRQRU0]V_Vdh(@_VbFqh( hh(T#d'ld'hh(ZZZ\]GRQUJP#d']P_Pdd'_@_Pbfd'_ MN0508ddcdg,]h_hdfh(@_hb]h( h(f#$':$'m(h(llllnopGdcgJb#$']b_bd$'_@_bbf$'_ MN0511wwvwz(]{_{d}h(@_{b6Jh( Xh(y#'ʃ'N`J(Xh(GwvzJu#']u_ud'_@_ubf'_ L]M_M6'T_K]L_Ld'_@_Lbf'_ #'GJ#'v'0(h(GHKGJFh($]F_FdVjh(@_Fb6h( {hVz8(4]_d((@_b( N0482eR1263F:)IlnMpN0492M]_dXU*@_b* Rs*:):S*ns*Rs*GJ:)Y]_bJ)  _dv+) @]_kVԊ(_T e]_bv)  _dv) @:t)C14F)IlnMp)Y]_bRJ)  _dޜ+) @]_knٯ(_T e]_bRv)  _dޜ) @t):t)t)P)MP)P)t)fLw(MfLw(fLw(f4{('(q(P)8*(l*( ( (fLw(GJ8*(8]_d8d5(@_b8' t8(<]_d8H(@_b8 ( @]_d8t\(@_b8( P12_0ORN12F@T)elngnqpN0505 T] _ d8(@_ b8N~( 8I) 8I)80L)"0L)p,)},)G J},)x]_d})@_b}T( N0506P] _ d8(@_ b8j( 8Z6)8Z6),5Z6)u(w)R(w)),)$$$$$$&'()*GJ,)}]_d)@_bT( t/f,)]/_/df)@_/bfT( N04966656 "2=$>&>)&>+&>-&>/1USERLED_BANK7>9>;E=E11=E22=E33=E44=E55=E66=E77=E88,L+H2LED_BANKVXS@.@.Z LED_Hole_26%]U_Ud.|d.@_Ub.. XSx.@.V]Z_Zd</|d.@_Zb</. XS*/@.V]^_^dH/|d.@_^bH/. XS$/@.V]b_bd/|d.@_bb/. XS60@.V]f_fdT0|d.@_fbT0. XS/@.V]j_jd\/|d.@_jb\/. XSD|0@.V]n_nd0|d.@_nb0. XS|0@.V]r_rd@0|d.@_rb@0.  ް/@.L8c8cp;:;w+Z]w_wdh+@_wbh, ;N0495~~~]_d&*@_b&,'* &)}&)&D+D+D+0>+G~}J|0>+^]|_|d[+@_|b[, ;+b]_d+@_b, ;L2+f]_dP+@_bP, ;N0494]_d*@_b,'* ))Z++GJ+j]_dH+@_bH, ;N0493]_d}*@_b},'* })})}D++++GJ+n]_d +@_b , ;+r]_dd+@_bd,  9U]:_:d+@_:b, +8f)f,*+++G659J4f)]4_4df*@_4bf,'* ]_.l)T]_d&)@_b&T( &,)8($Z(&])&,)GJ8(D]_d8o(@_b8.0( P12_1 "2$&)&+&-&/1USERSMD_HEADER_10P_2x579; =11=22=33=44=55=66=77=88=99=1010LLC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF11207.psl@2 HEADER 2X5BDSMD_HEADER_10P_2x5 LC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF11207.sslPP13Fu%H2SMD_HEADER_10P_2x5VX@.-ZStyle1_21_\]_d*.r-_@_bQ.r-_  X@.._\]_d*.._@_bQ.._ X@.t._\] _ d*.._@_ bQ.._ X@.0._\]_d*.._@_bQ.._ X@.h;/_\]_d*.RF/_@_bQ.RF/_ X//-_\]_d:/r-_@_b.r-_  X//._\]_d:/._@_b.._ X//t._\] _ d:/._@_ b.._ X//0._\]$_$d:/._@_$b.._ X//h;/_\](_(d:/RF/_@_(b.RF/_ ]_/A-T.t.eL8c8cp]/_/dP>$_@_/bq>$_  P1_RESETN555 "2<$=&=)&=+&=-&=/1SMSM04027=9=;D=D11=D22LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 R 2K7 0402BHDHRMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslRR133F;:nc(Il:n:Mp::N0485QQPQ "2X$Y&Y)&Y+&Y-&Y/1SMSM04027Y9Y;`=`11=`22LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 C 1N 0402BdDdCMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslCC133FWVn(IlVnVMpVUVkIU(e]k_kb7P(_ _kdU(_@]V_Vkξ|'PT_TY]U_UbjP(_ _Ud(_@(Sc((uuwQQy]z_zd[9W)@_zb[c) [J)Tx[J)J))̵(F((~~~~~~GQPTyJOc(Y]O_Obj(_ _Od(_@9]:_:kV'PT_8e]9_9b7(_ _9dU(_@IUc(47IUc(IU%%֠%f%G584IPowerÀ Power MinÀ Power Nom1M3f%]3_3dPv%_@_3bqv%_ P11_4]_d[ )@_b[b) [*([*(P;*(*(*(\'8%Bo%o%fu%GJfu% ]_dP%_@_bq%_ P12_2 "2$&)&+&-&/1SMSM040279;=11=22LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 R 4K7 0402BDRMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslRR14F l%IlnMpl%Y]_bM% _dl4t%@]_k>%Te]_bA% _d#4t%@#$l%#$l%֠l%f%%M%f%fܼ%%%W( 8")8")u") $_@_b8>$_ P11_6---0]1_1d[)0)@_1b[r<) [:(,/[:(| :(r0(r2(~r'~rP%,;%),;%OH%O%5555555555789:;<=>?G-0,J+O%]+_+dZv%_@_+b8v%_ P11_5FFFI]J_Jd[)@_Jb[() [(EH[(!( ( D%(ʏD'ʏD%NL%(L%Os%Ou%NNNNNNNNNNPQRSTUVWXGFIEJDOu% ]D_DdZ%_@_Db8%_ ]O4<&(]]_]dZG&_@_]b8G&_ ]_B$T$]_dZ%_@_b8%_ O%gIl%MgIl%O%~G%Il%iiiklgn*@]_k^ L*_TY]_bʑ(* _d>G)@td) "2$&)&+&-&/1USERCRYSTAL79;=11=22=33=44L,L] _ d42$/@_ b42/ X 81H/ ] _ d2*/@_ b2tf/ X pb2x. ] _ d42.@_ b42</ X 1x. ] _ dĹ1.@_ bĹ1</ X 1/ ] _ dĹ1$/@_ bĹ1/ ] _ 2@.T81H/L8c8cp   6\, ] _ d+0?,@_ b+z,    6+ ] _ d+x+@_ b+H+   G+ ] _ dex+@_ beH+   G\, ] _ de0?,@_ bez, ] _ V+T ] _ d+@_ b, + +y0+ À Style2_1_1@  G J y0+e] _ b=N+ _ d6/+@] _ kF+T Y] _ b+ _ d6*@*|  "2 $ & )& +& -& /1SMSM04027 9 ; = 11= 22LKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 C 1P8 0402B D CMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslCC1123F  *Il n Mp   Yv *e] _ bX*_ _ dvD,+_@] _ knT*T_ Y] _ b/*_ _ dD,+_@ *~ * * *   ÀStyle5   | {  \* * *     ! G|  { Jz \*e]z _z b * _z d6ݑ*@]e _e k O*_Tc Y]d _d b}* _d d6.*@_*b R&*&*"P* T*_*+ + + +  + - . / 0 G` _ c J^ R&*B ]^ _^ d<1*_@_^ bl1*_ * 5 R *G ]5 _5 d<v*_@_5 blv*_ * N0502< < < ? l]@ _@ dDj)@_@ b&j) j); > j))R)R()D D D D F G H G< ? ; J: R()K ]: _: d<)_@_: bl)_ * M &*O ]M _M d1*_@_M b1*_ * R  *S ]R _R dv*_@_R bv*_ ) ]* _* Z,)T( W ]) _) d)_@_) b)_ ()' Hj)>))()\ \ \ \ ^ _ ` G% $ ( J# Hj)h]# _# dj)@_# b:j) @ te 8j)p]e _e dj)@_e bj) tj j)t]j _j d4j)@_j b}j) N0504q q p q  "2x $y &y )&y +&y -&y /1SMSM04027y 9y ; = 11= 22 xLKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 R 56K 0402B D RMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslRR1271Fw v n2*Ilv nv Mpv u v  nK*e] _ b2i* _ d+_K*@]v _v kT@*Tt Y]u _u b27* _u d+')@nD*s (|j)%j)bH)bP*nD*      Gq p t Jo (|j)x]o _o dj)@_o bj) t [I)|] _ drI)@_ bI) t [Z6)] _ d[I~)@_ b[) N0507    "2 $ & )& +& -& /1SMSM04027 9 ; = 11= 22yLKC:\Documents and Settings\All Users\Documents\PCB Artist\Library\ProLib.psl@2 C 1U 0402B D CMC:\Documents and Settings\All Users\Documents\PCB Artist\Library\Discrete.sslCC1301F nT(Il n Mp   IUT(e] _ b7(_ _ dU,)_@] _ k4(PT_ Y] _ bj(_ _ d,)_@T( [")8") ) (T(T(       G J [")] _ d[j)@_ b[ w) z1J] _ d[(@_ b[)  )] _ d{)@_ b)  0(] _ d0Z)@_ b0,~)  $h(] _ d$Z)@_ b$})  >B)] _ d>g{)@_ b>)  )] _ d{)@_ b)  (] _ d!5)@_ bzX)  R(] _ dR4)@_ bR X)  (] _ d5)@_ bpX) ]_ 8(T]_dFCh(@_bh( h(h(8'(xe'e'       GJcD(Y]_bHb(_ _d(_@]_kN(T_e]_b^Hb(_ _dH|(_@{D(z CLw(M CLw({D(uD(CLw(     zz FuP)M FuP)y FuP)Fut)" " $ z % CLw(q,(q,(FuP)& & & & ( ) * z+ {D(D(8(, , , . / Gz }yJxFut)e]x_xbWv)  _xd) @]c_ckIJ(_T aY]b_bbWJ)  _bd+) @Fu)]`Fu)Fu*8<*R<*9 9 9 9 ; < = G^a]J\R<*@]\_\dx*@_\b* B <*I]B _B dnx*@_B bn*  E]_dnXU*@_bn* s* CJunctionJ )J )s*)M ÀO XM ÀN O ÀM TP5FW V ƿ)lV nV pV U ]V _V kFt*TT ]U _U bp) _U d;)*@ƿ)J S ƿ)ju))a Àd a Za c d Àa J Kh l)h l)g )l)j Àl Xj Àk l Àj T h p ƿ)ju)l)q Àt q Zq s t Àq h w l)3'&x À{ Xx Àz x Ày z { Àx GJ h  T  &] _ d.&@_ b'  NJ&] _ d8U.&@_ b8U' 1VBATT    ] _ dFS&@_ bΎ& 0^& 0^&& À p À  À   K % % 0^&%  À ' À '  $ & )& +& -& /1 "2 $ & )& +& -& /1USERDC_MOLEX_A-5569-02A2G7 9 ; = 11= 22= 33D+L*Il n Mp   OW*e] _ blu* _ dFEW*@] _ kfj߀*$T Y] _ blB* _ dF )@O*%* Od)O*%*   tt%C1191F  n*Il n Mp    n!*e] _ b28* _ d*@] _ k L*_T Y] _ b2K* _ dj)@n)t |)M |) n))|)   ÀStyle2_1  t0t )D)M )D) f,)%,))D)    tt!C1291F% $ n(Il$ n$ Mp$ # $ * IU(e]* _* b7)_ _* dUT_)_@]$ _$ k.(PT_" Y]# _# bj)_ _# dT_)_@(t4 :)M4 :)! (8):)6 6 6 8 9 tst; F(M; F(:  ((~(~(F(= = = = = ? @ A B ttD )p%MD )p%wC )p%*p%ه$F F ÀH F H I t tL 1)ML 1)K 1D*1)N N P tf k Q 8j)j)R R T tk L U j))X<)nE<)1)V V V V V X Y Z [ t \ j),)<)'<)&Kd)Od)] ] ] ] ] ] _ ` a b c t d hj)Fj)X)k)n)e Àj e  e  e  e  g h i j Àe t; m 8(h(h(F(n n n n p q r t tKt v'  H>'  ֍ ^ F+  >c F+  ֍ V,*  ,*  ֍ Nb (   (  ֍ 8e:)  :)  ֍ ,#  ,#  ֍ @"  "  ֍ 0i  0i  ֍ B(  bB(  ֍ &Y+  Y+  ֍ %  0%  ֍ &  B&  ֍ 0 )  V)  ֍ +  ~+ ֍ \,  ~\, ֍ '  x\'  ֍ 0/u!  vu!     ֍ V1lH(  xlH(   ֍ l(  ( ֍ ,l@A)  Й@A) ֍ 6l(  ڙ( ֍ s+  + ֍ (  ( ֍ 6A)  6A)  !֍ (  ( #""$֍ &+  FE+ &%%'֍ &\,  FE\, )((*֍    ,++-֍ (  d(( /..0֍ @)  x(@) 2113֍ (  (( 5446֍ .*  O* 8779֍ &  zU& ;::<֍ N$"  k" >==?֍ X*d)  sd) A@@B֍ (,(g  s(g DCCE֍ t(  ( GFFH֍ n$  $ JIIK֍ d&   d& MLLN֍ >s!  s! POOQ֍ 6%  % SRRT֍ \+  F.\+ VUUW֍ &  6& YXXZ֍ #  b# \[[]֍ V%'%  l'% _^^`֍ V%l%  ll% baac֍ 4 (  f| ( eddf֍ M   hggi֍ F{++@ Wl++@ >,*@ %+*@֍ fds(  ds( ֍ h$  )$ ֍ $  l>$ ֍ D)  <\&  d<\& ֍ :?  J? ֍ R"  " ֍ `++@ ++@ `,*@ Ѭ+*@֍ :)  f:) ֍  L*  f L* ֍ #  # ֍ !  G! ֍ +  + ֍ ^eL&  άL& ֍ V:)  6:) ֍ V)  6) ֍ ;  ; ֍ Z"  " ֍ x *   * ֍ ++  ++ ֍ ,$  {$ ֍ Jd0!  0! ֍ t{h#  h# ֍ ׅ,*a j<*  r<*` },*` rs*  js*a֍ B0^&  0^& ֍ B&  & ֍ Dj *  j * ֍ t;#  qt;# ֍ ^,)(  #,)( ֍ ^P)  #P) ֍ ^X$  NZX$ ֍ ^t/%  NZt/% ֍ ,*a <*   <*` %,*`  s*  s*a  ֍ 0^&  s0^&     ֍ &  s& ֍ QP)  P) ֍ lU  ܜ ֍ 0^&  Z0^& ֍ &  Z& ֍ }%  }% ֍ d  :d !  "֍ d!  :d! $##%֍ b++  k++ '&&(֍ VX$  HX$ *))+֍ V&  H& -,,.֍ Vl(  Hl( 0//1֍ V<)  H<) 3224Layer 3 CopperCCopperTerminalArray <O <Ot̍L: +$ l>$;;=569+$8+$t̍LA /$ B$BBD56@/$?/$t̍LH j$ $IIK56Gj$Fj$t̍LO $ #PPR56N$M$t̍LV $ )$WWY56U$T$t̍L] $ f$^^`56\$[$t̍Ld B$ h$eeg56cB$bB$t̍Lk Ԗ$ $lln56jԖ$iԖ$t̍Lr I' x\'ssu56qI'pI't̍Ly 7' 7b(zz|56x7'w7't̍L %' '56%'~%'t̍L 7' 7'567'7't̍L C) V)56C)C)t̍L 1) 1z)561)1)t̍L ) 0 )56 ) )t̍L 1) 1)561)1)t̍L `d) sd)56`d)`d)t̍L O@) O*56O@)O@)t̍L 2=d) X*d)562=d)2=d)t̍L O) O)56O)O)t̍L |) |)56 |) |)t̍L X) 2 *56X)X)t̍L |) |)56|)|)t̍L ) )56))t̍L b;D) >@56<)L%;)L%t̍LD p% 5p%EEG56Cp%Bp%t̍LK )$ )$LLN56J)$I)$r (e]r_rb(_ _rd8D8)_@]_k(T_Y]_b(_ _dpAD8)_@S (XX (MXX (S (X (ZZ\?]D'4(^^`a'D'bbde&'ffhjj *Mjj *i)P)j *lllnoq@A)ZStyle1_4q@A) p@A)))tttÀStyle1_1vw z(sz(y)8((|||x~(s( (((x z(((x (s(R(R((x (s(R(RL((x (s((((x (s((((x @)s@))@)@)x )((x 6A)s6A)>B)>@)6A)x >B)>t((x q0(0)@A)x 0((((x z0(((x $h(h((x $h($n)@)x $h($)6A)x 0(0)6A)x 0(0((x 0(0((x $h($((x $h($.((x $h(2h((x(((x(j((xq@A)@A)6A)x   @)*@)6A)   x%X$M%X$ %X$VX$ ,h#M,h#VX$VX$,h#C KP:<*P:<*<*P:<*  "X#V++V6!+P:<*$$$&')0 *M)0 *(P:<*L/<*0 *+++-.GX0^&M0^&2R'M:^$>'<^$m%M<^$m%>L&M>L&@@<\&M@@<\&Bo#MBo#D%&MD%&F%l(MF%l(H%<)MH%<)jJ:)MJ:)L L*ML L*N \+MN \+PY+MPY+R+*MR+*T (MT (VI'%MVI'%X1&MX1&Z,)(MZ,)(qz?l  +  8 =  6 N S SXC x TP1F_^; F+l^n^p^]]^_^kNx+T\]]_]bYc+ _]dԷv+@; F+TP2Flkb;#lknkpkj]k_kkX#Ti]j_jb&YL# _jdh#@b;#TP3Fyx,#lxnxpxw]x_xkn#Tv]w_wb# _wd)$@,#TP4Fƿ:)lnp]_kFdm)T]_b`X) _d;)@ƿ:)  "2$&)&+&-&/1USERBattClip79;=11=22=33 LHC:\Documents and Settings\All Users\Documents\PCB Artist\Library\MSD.psl@2BattClipBDBattClipHC:\Documents and Settings\All Users\Documents\PCB Artist\Library\MSD.sslPP15F*tdH2BattClipVXXB8pb2ZStyle5,L3]_d`8D2@_b`842 X9pb2]_dĻ9D2@_bĻ942 X,82]_d 9Ľ2@_b 9L2 P82CM8c8cpz]_d>@_b>h NnO]_d1@_bPm  ]_d9@_b9h ")"M"Ru!MRu!Ҵ0i MҴ0i H"MH"s!Ms!O(g MO(g   "M  "Ҝ~!MҜ~!` M` fv"Mfv":$!M:$!^? M^? "M"0!M0!d; Md; :d M:d :d!M:d!$y M$y ̍L 5, , c =c c ^c ^, 6 ," J\,  h\,# 6, Y," \,  \,#֍ m%  Km% ֍ >'  K>' ֍  F+  f F+ ֍ S,*  ,* ֍ :d:)  :) ֍ ܂,#  P,#  ֍ F"  "     ֍ 0i  0i   ֍ N(o T_ (o N=( N6"( B(  ^B( 6"( L' =& R&ȯ `4& y&! d&7 & N]'j v]'  'w A( A( A(( Z/lH(  zlH( jh(( jh( 6&  d& ?_& p$ $  r$r $ X& J(& 5(&ȯ (Կ& 6'ȯ ND' !"#$%&'()*+,-./012345֍ ,Y+  Y+ 7668֍ |%ݾ %  ~2%ܾ %|% %h$ ԝ# #; _#! # #ȯ *# @L$ȯ x^$:9999999999999;<=>?@ABCDEF֍ &  E& HGGI֍ +  + KJJL֍ 2 )  W) NMMO֍ 6,u!  yu! QPPR֍ 0j@A)  ̛@A) TSSU֍ :j(  ֛( WVVX֍ k(  ( ZYY[֍ .p+  + ]\\^֍ (  ( `__a֍ (  ( cbbd֍ 6A)  6A) feeg֍ h+  J+ ihhj֍ r   lkkm֍ @)  t*@) onnp֍ (  b)( rqqs֍ (  )( uttv֍ 4*  R* xwwy֍  &  tX& {zz|֍ T!"  n" ~}}֍ .)(g  v(g ֍ Z)d)  td) ֍ s(  ( ֍ Ds!  s! ֍ \+  @1\+ ֍ % |%ȯ >, & VnE& Vn( 1 ( Vn( Vn)ȯ t) U%) B))( wLݛ( ^(( /(( L(N Lw(0/ _( o&ȯ Nb& j\/& j\% nl%  Z#l% 5% 54 &ȯ ^;& Bw& B4( ) ( @&ȯ bw& Jw% J% %  :%֍ &  9& ֍ (#  e# ֍ \"'%  o'% ֍ Q  * ֍ ˳+  u_+ ֍ Z "   " ֍ "|)  |) ֍ X$&  @$& ֍   E ֍ +D: +D: ,= w\+=֍ +==?֍ `"  " A@@B֍ ~ *  ! * DCCE֍ *$  r}$ GFFH֍ -++  ++ JIIK֍ Pa0!  0! MLLN֍ zxh#  h# POOQ֍ * |h<*  <* 8*h ڿs*  zis*iSRRRRRRTUVWX֍ 0^&  N0^& ZYY[֍ &  N& ]\\^֍ Tt;#  X|t;# `__a֍ Jj *  j * cbbd֍ d,)(  &,)( feeg֍ X$  dX$ ihhj֍ t/%  ct/% lkkm֍ ,* "<*  !<* ,* !s*  "s*onnnnnnpqrst֍ 0^&  u0^& vuuw֍ &  u& yxxz֍ rR  ֟ |{{}֍ N0^&  0^& ~~֍ N&  & ֍ "}%  }% ֍ d  =d ֍ d!  =d! ֍ \X$  KX$ ֍ \&  K& ֍ \l(  Kl( ֍ \<)  K<) ֍ ++  h]++ 65,5,̍L *7\, J\,6*7\,*7\,̍L B\, h\,6B\,B\,̍L 64, 6&!,664,64,̍L *7+ J+6*7+*7+̍L 6x+ 6R+66x+6x+̍L B+ h+6B+B+̍L 6m+ 6Z+66m+6m+̍L p+ +6p+p+̍L Gx+ GR+6Gx+Gx+̍L + +6++̍L Gm+ GZ+6Gm+Gm+̍L p\, \,6p\,p\,̍L \, \,6\,\,̍L G4, G&!,6G4,G4,̍L ~it;# X|t;#6~it;#~it;#̍L V# Vv#   6V#V#̍L .t;# Tt;#6.t;# .t;#̍L VL" Vr"6VL"VL"̍L RX$ dX$ 6RX$RX$̍L$ VT$ V.$%%'6#VT$"VT$̍L+ X$ X$,,.6*X$)X$̍L2 V%$ V $33561V%$0V%$̍L9 ++ ++::<68 ++7 ++̍L@ |k+ V~+AAC6?|k+>|k+̍LG Bp++ h]++HHJ6FBp++EBp++̍LN * *OOQ6M*L*̍LU ++ -++VVX6T++S++̍L\ V|k+ VV~+]]_6[V|k+ZV|k+̍Lc ++ ++ddf6b++a++̍Lj V* V*kkm6iV*hV*̍Lq <* <*rrt6p<*o<*̍Lx * j*yy{6w*v*̍L V{<* |h<*6~V{<*}V{<*̍L + ϭ+6++̍L  , #,6 , ,̍L k+ +6k+k+̍L I+ #+6I+I+̍L  , #,6 , ,̍L k+ +6k+k+̍L I+ w\+6I+I+̍L L2 , L2#,6L2 ,L2 ,̍L L2k+ L2+6L2k+L2k+̍L + ˳+6++̍L  , #,6 , ,̍L Or+ u_+6Or+Or+̍L k+ +6k+k+̍L .S F+ f F+6.S F+.S F+̍L ;l]+ ;Fp+6;l]+;l]+̍L n$ F+  F+6n$ F+n$ F+̍L ;.+ ;+6;.+;.+̍L R# e#6R#R#̍L b;# b;µ#6b;#b;#̍L  $# (#  6 $# $#̍L b;(t# b;Na#6b;(t#b;(t#̍L v,# P,#6v,#v,#̍L  # f#!!#6##̍L' ,# ܂,#((*6&,#%,#̍L. ̬# #//16-̬#,̬#̍L5 &:) :)66864&:)3&:)̍L< ƿQ) ƿd)==?6;ƿQ):ƿQ)̍LC f:) :)DDF6Bf:)Af:)̍LJ ƿ<#) ƿb)KKM6Iƿ<#)Hƿ<#)̍LQ @> QRRT6P@>O@>̍LX " "YY[6W"V"̍L_  *``b6^]̍Lf " "ggi6e"d"̍Lm  rnnp6lk̍Lt z zuuw6szrz̍L{ \ ||~6z\y\̍L z z6zz̍L ng “u6ngng̍L .Vg Hu6.Vg.Vg̍L X( X(6X(X(̍L D ( 1 (6D (D (̍L X4( XZ(6X4(X4(̍L 6&& 9&66&&6&&̍L ^l' ^F'6^l'^l'̍L & &6&&̍L ^& ^&6^&^&̍L h# h#6h#h#̍L ,@# ,#6,@#,@#̍L Th# zxh#6Th#Th#̍L ,# ,#6,#,#̍L fNz1*=Nz1*̍LF vf,* S,*GGI6Evf,*Dvf,*̍LM NzT * Nzz)NNP6LNzT *KNzT *̍LT 68>' K>'UUW6S68>'R68>'̍L[ ^$R' ^$~e'\\^6Z^$R'Y^$R'̍Lb >' >'cce6a>'`>'̍Li ^$*' ^$'jjl6h^$*'g^$*'̍Lp 68m% Km%qqs6o68m%n68m%̍Lw ^$́% ^$%xxz6v^$́%u^$́%̍L~ m% m%6}m%|m%̍L ^$Z% ^$BG%6^$Z%^$Z%̍L L& ȯL&6L&L&̍L $& ,&6$&$&̍L >uL& dbL&6>uL&>uL&̍L t% %6t%t%̍L T<\& g<\&6T<\&T<\&̍L @p& @&6@p&@p&̍L -<\& D<\&6-<\&-<\&̍L @dH& @5&6@dH&@dH&̍L ҃# #6҃#҃#̍L o`# o:#6o`#o`#̍L "\# HI#6"\#"\#̍L ow# od#6ow#ow#̍L 8X$ KX$68X$8X$̍L %tl$ %N$6%tl$%tl$̍L 6X$ \X$66X$6X$̍L %D$ %1$6%D$%D$̍L 8& K&68&8&̍L %t& %N&6%t&%t&̍L  6& \&   6 6&6&̍L %ĵ& %&6%ĵ&%ĵ&̍L 8l( Kl(68l(8l(̍L %D( %(  "6%D(%D(̍L& 6l( \l('')6%6l($6l(̍L- %( %(..06,%(+%(̍L4 8<) K<)557638<)28<)̍L; %) %)<<>6:%)9%)̍LB 6<) \<)CCE6A6<)@6<)̍LI %d) %)JJL6H%d)G%d)̍LP j * j *QQS6Oj *Nj *̍LW B * 3*XXZ6VB *UB *̍L^ $j * Jj *__a6]$j *\$j *̍Le ) )ffh6d)c)̍Ll :) `:)mmo6k:)j:)̍Ls tN) Na)ttv6rtN)qtN)̍Lz ֵ:) :){{}6yֵ:)xֵ:)̍L &) )6&)&)̍L  L* ` L*6 L* L*̍L _* r*6_*_*̍L ֵ L*  L*6ֵ L*ֵ L*̍L 48* Z%*648*48*̍L f\+ @1\+6f\+f\+̍L 4#+ 6+6 4#+ 4#+̍L \+ \+6\+\+̍L * *6 * *̍L Y+ Y+6Y+Y+̍L lm+ F+6lm+lm+̍L Y+ ,Y+6Y+Y+̍L E+ 2+6E+E+̍L ?* R*6?*?*̍L + + ++6+ ++ +̍L * 4*6**̍L +* +:*6+*+*̍L ( 2(6((̍L .r ( T_ (6.r (.r (̍L ' .' 6''̍L  \'% o'%6 \'% \'%̍L I|;% IVN%6I|;%I|;%̍L 65'% \"'%665'%65'%̍L" I% I%##%6!I% I%̍L) E& tX&**,6(E&'E&̍L0 1& 1α&1136/1&.1&̍L7 &  &88:66&5&̍L> 1Dw& 1jd&??A6=1Dw&<1Dw&̍LE ,)( &,)(FFH6D,)(C,)(̍LL =( O(MMO6K=(J=(̍LS >,)( d,)(TTV6R>,)(Q>,)(̍LZ T( z([[]6YT(XT(̍La @A) ̛@A)bbd6`@A)_@A)̍Lh 6F) Z)iik6g6F)f6F)̍Lo ~@A) 0j@A)ppr6n~@A)m~@A)̍Lv J<) r()wwy6uJ<)tJ<)̍L} ( (~~6|({(̍L ( )6((̍L }( k(6}(}(̍L ( @(6((̍L ( ֛(6((̍L ( (6((̍L ~( :j(6~(~(̍L ( $(6((̍L ( (6((̍L ޷( (6޷(޷(̍L ( (6((̍L ( (6((̍L ( (6((̍L ( )6((̍L ( (6((̍L ( 6(6((̍L 6A) 6A)66A)6A)̍L ,F) Y)6,F),F)̍L 6A) 6A)66A)6A)̍L @<) f))6@<)@<)̍L  ( )(   6((̍L ( r(6((̍L ( (6 ( (̍L ( Қ(!6((̍L% ( b)(&&(6$(#(̍L, ( )--/6+(*(̍L3 ( (44662 (1 (̍L: ( (;;=69(8(̍LA @) t*@)BBD6@@)?@)̍LH E) Y)IIK6GE)FE)̍LO @) @)PPR6N @)M @)̍LV ;) "()WWY6U;)T;)̍L]  * ! *^^`6\ *[ *̍Ld 0* 0ҳ*eeg6c0*b0*̍Lk X * ~ *lln6jX *iX *̍Lr 0Hy* 0nf*ssu6q0Hy*p0Hy*̍Ly " "zz|6x"w"̍L " r"6"~"̍L " F"6 " "̍L r" `"6r"r"̍L fu! yu!6fu!fu!̍L Rȉ! R!6Rȉ!Rȉ!̍L ?u! 6,u!6?u!?u!̍L Rb! R>O!6Rb!Rb!̍L 0i  0i 60i 0i ̍L Ҵ}  Ҵ 6Ҵ} Ҵ} ̍L 0i  0i 60i 0i ̍L ҴXU  Ҵ~B 6ҴXU ҴXU ̍L [" n"6["["̍L H" Hj"6H"H"̍L .4" T!"6.4".4"̍L Hp" H^"6Hp"Hp"̍L s! s!6s!s!̍L ! !6!!̍L s! Ds!6s!s!̍L `! 6M!6`!`!̍L c(g  v(g 6c(g c(g ̍L  O{  Oڍ   6 O{ O{ ̍L <(g  .)(g 6<(g <(g ̍L OPS  Ov@ 6OPS OPS ̍L!  "  """$6  " "̍L( " "))+6' "& "̍L/ 4 " Z "0026.4 "-4 "̍L6 2" X"77965 2"4 2"̍L= ~! ~!>>@6<~!;~!̍LD ҜV! Ҝ0!EEG6CҜV!BҜV!̍LK ~! v~!LLN6J~!I~!̍LR Ҝ! Ҝp!SSU6QҜ!PҜ!̍LY 82  E ZZ\6X82 W82 ̍L` `  `b aac6_` ^` ̍Lg    hhj6f  e  ̍Ln `z  `g ooq6m`z l`z ̍Lu >" "vvx6t>"s>"̍L| fv" fv"}}6{fv"zfv"̍L b" O"6b"b"̍L fvD" fvj"6fvD"fvD"̍L 8! J!68!8!̍L :$h! :$B!6:$h!:$h!̍L b! !6b!b!̍L :${! :$h!6:${!:${!̍L jr?  D? 6jr? jr? ̍L ^nS  ^Hf 6^nS ^nS ̍L J?  7? 6J? J? ̍L ^+  ^ 6^+ ^+ ̍L " "6""̍L " "6""̍L :" `"6:":"̍L (" N"6("("̍L ڛ0! 0!6ڛ0!ڛ0!̍L ! !6!!̍L *t0! Pa0!6*t0!*t0!̍L X! ~!6X!X!̍L <;  ; 6<; <; ̍L dO  db    6dO dO ̍L ;  ; 6; ; ̍L d'  d$ 6d' d' ̍L +d  =d  6+d +d ̍L$ :<  :/ %%'6#:< ":< ̍L+ bd  d ,,.6*bd )bd ̍L2 : :33561:0:̍L9 +d! =d!::<68+d!7+d!̍L@ ::'  I>' ~~֍q ` F+  $& !  "֍q Fe'  ?e' $##%֍q   C '&&(֍q +D: +D: ,= w\+=*))))+,-֍q VLw(  fLw( /..0֍q -֍q fds(  ds( @??A֍q f$  ($ CBBD֍q $  n=$ FEEG֍q D)  >MD) IHHJ֍q 3p%  Mp% LKKM֍q @<\&  e<\& ONNP֍q 9?  H? RQQS֍q Q"  " UTTV֍q R`+D: +D: R`,= ϭ+=XWWWWYZ[֍q :)  d:) ]\\^֍q  L*  d L* `__a֍q #  # cbbd֍q !  H! feeg֍q +  + ihhj֍q `dL&  ̭L& lkkm֍q X:)  4:) onnp֍q V)  6) rqqs֍q ;  ; uttv֍q \"  " xwwy֍q z *   * {zz|֍q  ++  ++ ~}}֍q ,$  {$ ֍q Lc0!  0! ֍q vzh#  h# ֍q * i<*  p<* դ* rs*  js*֍q B0^&  0^& ֍q B&  & ֍q Fj *  j * ֍q t;#  rt;# ֍q `,)(  $,)( ֍q ^P)  #P) ֍q `X$  L[X$ ֍q ^t/%  NZt/% ֍q ,*a <*   <*` %,*`  s*  s*a֍q 0^&  s0^& ֍q &  s& ֍q QP)  P) ֍q nT  ڝ ֍q 0^&  Z0^& ֍q &  Z& ֍q }%  }% ֍q d  ;d ֍q d!  ;d! ֍q `++  j++ ֍q XX$  IX$ ֍q X&  I& ֍q Xl(  Il( ֍q X<)  I<) Layer 2 Copper6p?<o?<̍L j3\, DF\,6j3\,j3\,̍L 6(, 6,66(,6(,̍L \, (\,6\,\,̍L 67, 6$,667,67,̍L j3+ DF+6j3+j3+̍L 6+ 6+66+6+̍L + (+ 6++̍L 6Pq+ 6v^+6 6Pq+ 6Pq+̍L l+ +6l+l+̍L G+ G+6G+G+̍L# "+ +$$&6""+!"+̍L* GPq+ Gv^+++-6)GPq+(GPq+̍L1 l\, \,22460l\,/l\,̍L8 G(, G,99;67G(,6G(,̍L? "\, \,@@B6>"\,="\,̍LF G7, G$,GGI6EG7,DG7,̍LM _t;# rt;#NNP6L_t;#K_t;#̍LT V|# Vڎ#UUW6SV|#RV|#̍L[ t;# t;#\\^6Zt;#Yt;#̍Lb V" V"cce6aV"`V"̍Li rHX$ L[X$jjl6hrHX$grHX$̍Lp V$ V$qqs6oV$nV$̍Lw :X$ `X$xxz6v:X$u:X$̍L~ V/$ V$6}V/$|V/$̍L ++ `++6++++̍L ]+ p+6]+]+̍L }++ j++6}++}++̍L 8* ^*68*8*̍L 6 ++  ++66 ++6 ++̍L V]+ Vp+6V]+V]+̍L v++ ++6v++v++̍L V8* V^*6V8*V8*̍L <* p<*6<*<*̍L (* *6(*(*̍L |<* i<*6|<*|<*̍L + ϭ+6++̍L  , #,6 , ,̍L k+ +6k+k+̍L I+ #+6I+I+̍L  , #,6 , ,̍L k+ +6k+k+̍L I+ w\+6I+I+̍L L2 , L2#,6L2 ,L2 ,̍L  L2k+ L2+   6 L2k+L2k+̍L + ˳+6++̍L  , #,6 , ,̍L Or+ u_+  "6Or+Or+̍L& k+ +'')6%k+$k+̍L- bQ F+ 6::& F+9:& F+̍LB ;x0+ ;+CCE6A;x0+@;x0+̍LI P# c#JJL6HP#GP#̍LP b;# b;#QQS6Ob;#Nb;#̍LW %# #XXZ6V%#U%#̍L^ b;u# b;c#__a6]b;u#\b;u#̍Le ,# ,#ffh6d,#c,#̍Ll # #mmo6k#j#̍Ls ,# ,#ttv6r,#q,#̍Lz # #{{}6y#x#̍L Z:) 4:)6Z:)Z:)̍L ƿ0P) ƿ c)6ƿ0P)ƿ0P)̍L 2:) X:)62:)2:)̍L ƿ%) ƿ.)6ƿ%)ƿ%)̍L ; N6;;̍L "` ":6"`"`̍L f 6ff̍L " "6""̍L 6 666̍L z` z:6z`z`̍L  6̍L z z6zz̍L O O6 O O̍L NnHo Nn"6NnHoNnHo̍L NO ;O6NONO̍L j ( d} (6j (j (̍L X( X(6X(X(̍L F ( 3 (6F (F (̍L X0( XV(6X0(X0(̍L :$& 7& 6:$&:$&̍L  ^p' ^J'6 ^p' ^p'̍L & &6&&̍L ^& ^&6^&^&̍L" h# h###%6!h# h#̍L) ,D# ,#**,6(,D#',D#̍L0 Ph# vzh#1136/Ph#.Ph#̍L7 ,# ,#88:66,#5,#̍L> d$&[[]6Y+$&X+$&̍La & 'bbd6` &_ &̍Lh .$& T$&iik6g.$&f.$&̍Lo H& n&ppr6n H&m H&̍Lv :0& C&wwy6u:0&t:0&̍L} ^& ^ү&~~6|^&{^&̍L & &6 & &̍L ^@y& ^ff&6^@y&^@y&̍L *,* ,*6*,**,*̍L Nz/* NzA*6Nz/*Nz/*̍L rh,* U,*6rh,*rh,*̍L NzP * Nzv)6NzP *NzP *̍L :6>' I>'6:6>':6>'̍L ^$P' ^$c'6^$P'^$P'̍L >' >'6>'>'̍L ^$,' ^$'6^$,'^$,'̍L :6m% Im%6:6m%:6m%̍L ^$% ^$%6^$%^$%̍L m% m%6m%m%̍L ^$\% ^$>I%6^$\%^$\%̍L L& ̭L&6L&L&̍L (& +&6(&(&̍L :wL& `dL&6:wL&:wL&̍L p% %6p%p%̍L R<\& e<\&   6 R<\& R<\&̍L @n& @& 6 @n& @n&̍L /<\& @<\&   6 /<\& /<\&̍L @`J& @7&   6 @`J& @`J&̍L ց# #  ! 6 ց# ց#̍L% od# o>#& & ( 6$ od## od#̍L, ^# DK#- - / 6+ ^#* ^#̍L3 oy# of#4 4 6 62 oy#1 oy#̍L: 6X$ IX$; ; = 69 6X$8 6X$̍LA %xj$ %R}$B B D 6@ %xj$? %xj$̍LH 2X$ XX$I I K 6G 2X$F 2X$̍LO %F$ %3$P P R 6N %F$M %F$̍LV 6& I&W W Y 6U 6&T 6&̍L] %x& %R&^ ^ ` 6\ %x&[ %x&̍Ld 2& X&e e g 6c 2&b 2&̍Lk %& %&l l n 6j %&i %&̍Lr 6l( Il(s s u 6q 6l(p 6l(̍Ly %H( %"(z z | 6x %H(w %H(̍L 2l( Xl( 6 2l(~ 2l(̍L %( %( 6 %( %(̍L 6<) I<) 6 6<) 6<)̍L %) %) 6 %) %)̍L 2<) X<) 6 2<) 2<)̍L %`) %) 6 %`) %`)̍L j * j * 6 j * j *̍L F*  1* 6 F* F*̍L j * Fj * 6  j * j *̍L ) ) 6 ) )̍L :) d:) 6 :) :)̍L xL) R_) 6 xL) xL)̍L ҷ:) :) 6 ҷ:) ҷ:)̍L () ) 6 () ()̍L  L* d L* 6  L*  L*̍L ]* p* 6 ]* ]*̍L ҷ L*  L* 6 ҷ L* ҷ L*̍L 0:* V'* 6 0:* 0:*̍L j\+ D/\+ !6 j\+ j\+̍L! 8!+ 4+!!!6! 8!+! 8!+̍L ! \+ \+ ! !!6 !\+ !\+̍L! * *!!!6! *! *̍L! Y+ Y+!!!6!Y+!Y+̍L!! pk+ J~+"!"!$!6 !pk+!pk+̍L(! Y+ (Y+)!)!+!6'!Y+&!Y+̍L/! G+ 4+0!0!2!6.!G+-!G+̍L6! =* P*7!7!9!65!=*4!=*̍L=! + + ++>!>!@!6"(̍LG" ( 6(H"H"J"6F"(E"(̍LN" 6A) 6A)O"O"Q"6M"6A)L"6A)̍LU" ,F) Y)V"V"X"6T",F)S",F)̍L\" 6A) 6A)]"]"_"6["6A)Z"6A)̍Lc" @<) f))d"d"f"6b"@<)a"@<)̍Lj" ( )(k"k"m"6i"(h"(̍Lq" ( r(r"r"t"6p"(o"(̍Lx" ( (y"y"{"6w" (v" (̍L" ( Қ("""6~"(}"(̍L" ( b)("""6"("(̍L" ( )"""6"("(̍L" ( ("""6" (" (̍L" ( ("""6"("(̍L" @) v)@)"""6"@)"@)̍L" E) X)"""6"E)"E)̍L" @) @)"""6" @)" @)̍L" ;)  ))"""6";)";)̍L"  *  *"""6"  *"  *̍L" 0* 0ֱ*"""6"0*"0*̍L" T * z *"""6"T *"T *̍L" 0D{* 0jh*"""6"0D{*"0D{*̍L" Ծ" """"6"Ծ""Ծ"̍L" " v""""6""""̍L" " B""""6""""̍L" t"  b""""6"t""t"̍L" du! wu!"""6"du!"du!̍L" Ṙ! R!""#6"Ṙ!"Ṙ!̍L# Au! 2.u!###6# Au!# Au!̍L # Rd! R:Q! # ##6 #Rd! #Rd!̍L# 0i  0i ###6#0i #0i ̍L# Ҵ {  Ҵ ###6#Ҵ { #Ҵ { ̍L # 0i  0i !#!###6#0i #0i ̍L'# ҴTW  ҴzD (#(#*#6&#ҴTW %#ҴTW ̍L.# Y" l"/#/#1#6-#Y",#Y"̍L5# H" Hn"6#6#8#64#H"3#H"̍L<# *6" P#"=#=#?#6;#*6":#*6"̍LC# Hr" H`"D#D#F#6B#Hr"A#Hr"̍LJ# s! s!K#K#M#6I#s!H#s!̍LQ# ą! !R#R#T#6P#ą!O#ą!̍LX# s! @s!Y#Y#[#6W#s!V#s!̍L_#  b! 2O!`#`#b#6^# b!]# b!̍Lf# a(g  t(g g#g#i#6e#a(g d#a(g ̍Lm# Oy  Oދ n#n#p#6l#Oy k#Oy ̍Lt# >(g  *+(g u#u#w#6s#>(g r#>(g ̍L{# OLU  OrB |#|#~#6z#OLU y#OLU ̍L#  "  "###6# "# "̍L# " "###6# "# "̍L# 0 " V "###6#0 "#0 "̍L# ." T"###6# ."# ."̍L# ~! ~!###6#~!#~!̍L# ҜZ! Ҝ4!###6#ҜZ!#ҜZ!̍L# ~! x~!###6#~!#~!̍L# Ҝ! Ҝr!###6#Ҝ!#Ҝ!̍L# <0  C ###6#<0 #<0 ̍L# `  `f ###6#` #` ̍L#    ###6#  #  ̍L# `|  `i ###6#`| #`| ̍L# B" "###6#B"#B"̍L# fv" fv"###6#fv"#fv"̍L# d" Q"###6#d"#d"̍L# fv@" fvf"###6#fv@"#fv@"̍L# 6! H!###6#6!#6!̍L# :$l! :$F!###6#:$l!#:$l!̍L$ ^! !$$$6#^!#^!̍L$ :$}! :$j!$$ $6$:$}!$:$}!̍L$ np?  H? $$$6 $np? $np? ̍L$ ^rQ  ^Ld $$$6$^rQ $^rQ ̍L$ L?  9? $$$6$L? $L? ̍L#$ ^-  ^ $$$$&$6"$^- !$^- ̍L*$ " "+$+$-$6)$"($"̍L1$ " "2$2$4$60$"/$"̍L8$ 6" \"9$9$;$67$6"6$6"̍L?$ $" J"@$@$B$6>$$"=$$"̍LF$ ޙ0! 0!G$G$I$6E$ޙ0!D$ޙ0!̍LM$  ! !N$N$P$6L$ !K$ !̍LT$ &v0! Lc0!U$U$W$6S$&v0!R$&v0!̍L[$ T! z!\$\$^$6Z$T!Y$T!̍Lb$ @;  ; c$c$e$6a$@; `$@; ̍Li$ dM  d` j$j$l$6h$dM g$dM ̍Lp$ ;  ; q$q$s$6o$; n$; ̍Lw$ d)  d  x$x$z$6v$d) u$d) ̍L~$ )d  ;d $$$6}$)d |$)d ̍L$ :@  :- $$$6$:@ $:@ ̍L$ ^d  d $$$6$^d $^d ̍L$ : :$$$6$:$:̍L$ )d! ;d!$$$6$)d!$)d!̍L$ :@! :!$$$6$:@!$:@!̍L$ ^d! d!$$$6$^d!$^d!̍L$ :! :!$$$6$:!$:!̍L$   ڝ $$$6$ $ ̍L$ $y  $yZ $$$6$$y $$y ̍L$ Hg  nT $$$6$Hg $Hg ̍L$ $yȈ  $yu $$$6$$yȈ $$yȈ ̍L$ 5, , |( J|( V9O  FO |( ^|( ^, 6 ," J\,  h\,# 6, Y," \,  \,#$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$֍$ m%  Km% $$$$֍$  F+  f F+ $$$$֍$ 5( 5R( 5V( 5( 5) /r) /rV)5 b:)  ›]) S])$ ^) )ȯ H) ) ) +* +* l* Xl* 4l* l* l* Nl* N+* M+* M) G)_ W() X() g ) zY)#; ԡ) ԡ) 2) f) fn) {n) {) z) zD#* {D#* {;* V;* V@* 6@* 6s* 6* 6F* VF* V* 6* 68+ 6 + 6&+M zy0+ z+ .p+  + + y0+M &+  + 8+ * 4* 4D* D* * s* @* ֺ@* ֺ;* ;* D#* D#* ) ) n) >n) >) o) ) n) 6n) 6) 8) 88* 8D#* 8<* <* D#* 8* ) ) n) n) ,)h () S() )() 'd) F3$* F37* H27* H2x* kx* k7* j7* j$* Rvd) GC) )?) a) r) r* u* ub9* tb9* ty* <y* <;* ;* 9J* 9J* m* m* * >* >* J* J)ȯ )) l) l) +) +) * * ) b) b* V* V) @W) @Wo* do* d7K* W7K* W==* ̐==* ̐) Ώ) Ώ ) ) ) ) `;* 4`;* 4) F)0  |)RL 7) 67) 6F) QF) #) f) fd) f) fl) Jjl) Jj? + V4+ȯ + u+  +D: ,= w\+= +R b+ b+ "+ W+ Wl+D: ,= #+= +~< Bm+ B"+ 1+ 1+ +D: R`,= ϭ+= R`+yA :X+ :X+ȯ RL+ ? + * + ]+ +  + J+ J+ȯ + '* l) l) ) d) ) )01 PD)d mЌ) Ќ) ) ) ) ])ȯ P) g(ȯ $Zf( 0zf(6u ` ( u|( |(ȯ Bе( 6ݛ( Lw( <W( 8.W( ZLw(  hLw(7 gn( ouL`( "L`( L`( L`( 4j(7 jds(  ds( N( >( (( (( "(( \(( \(1( (1(ȯ 6( 2R( -R( -y( q ( & ( & ( : ( .A ( u ( u ( a ( %( u( ?u( ?8' 8' ' 'Z ' ?' ?g' g' ' ' {' F'ȯ L}' i' P\' ?P\' ?& & s+' J' & & ?& ?XN& XN& Ӟ& v&ȯ ʢ& ʢe' )H' uH' u' .A' :' &' &' 3' Ae'w; P' xP'̯ FiW' ~ ( ~' |' |' 0[' 0['D ' NW' N=% >M%e -% % H% H4% 4% %ȯ & &ȯ $& K$& Kc& (c& ($& $& b& b& & PH& |2% % X% 'X%[A Rpl%U &% 1 %b %pF H% H% O% yFO% ;D% AG>9% >9% $ $ '% *'% *$ L$ L% %ȯ l% G%ȯ A% A%' " >' " AW' AG( 6G( 6y( 5y($$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$%%%%%%%%% % % % % %%%%%%%%%%%%%%%%%%% %!%"%#%$%%%&%'%(%)%*%+%,%-%.%/%0%1%2%3%4%5%6%7%8%9%:%;%<%=%>%?%@%A%B%C%D%E%F%G%H%I%J%K%L%M%N%O%P%Q%R%S%T%U%V%W%X%Y%Z%[%\%]%^%_%`%a%b%c%d%e%f%g%h%i%j%k%l%m%n%o%p%q%r%s%t%u%v%w%x%y%z%{%|%}%~%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%&&&&&&&&& & & & & &&&&&&&&&&&&&&&&&&& &!&"&#&$&%&&&'&(&)&*&+&,&-&.&/&0&1&2&3&4&5&6&7&8&9&:&;&<&=&>&?&@&A&B&C&D&E&F&G&H&I&J&K&L&M&N&O&P&Q&R&S&T&U&V&W&X&Y&Z&֍$ S,*  ,* \&[&[&]&֍$ ܂,#  P,# _&^&^&`&֍$ F"  " b&a&a&c&֍$ 0i  0i e&d&d&f&֍$ ,Y+  Y+ h&g&g&i&֍$ &  E& k&j&j&l&֍$ +  + n&m&m&o&֍$ 6,u!  yu! q&p&p&r&֍$ h+  J+ t&s&s&u&֍$ r   w&v&v&x&֍$ *$ L$ L$ *$z&y&y&y&y&{&|&}&֍$ 4*  R* &~&~&&֍$  &  tX& &&&&֍$ T!"  n" &&&&֍$ .)(g  v(g &&&&֍$ h$ $ $ $ $ @$ m@$ < j$F qh$&&&&&&&&&&&&&&&&&&֍$ Ds!  s! &&&&֍$ \+  @1\+ &&&&֍$ &  9& &&&&֍$ l&qF d&qF & !&ȯ /& & n& nH% H% $ n$ nF$ F$ $ ֬$ ֬H% H%  % l&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&֍$ (#  e# &&&&֍$ \"'%  o'% &&&&֍$ Q  * &&&&֍$ ˳+  u_+ &&&&֍$ Z "   " &&&&֍$ X$&  @$& &&&&֍$   E &&&&֍$ EE$ E$ 4$ 4E$&&&&&&&&֍$ HI#  # &&&&֍$ v~!  ~! &&&&֍$ 4& 4J% EJ% E&&&&&&&&&֍$ D<\&  g<\& &&&&֍$ ${ j${ |$ I|$ ,G$o p%  /Qp%c Q% C\$ C\'% C\t3% C\f% ӓf% ӓ\% \% i% ʦi% ʦ% % .% .% % !% !.% #.% #% 2% 2i% i% &% &% 0% ӓ0% ӓ'% ӓ% % f$% f$% <% D<% _<% 0y<% 0y$ _$ D$ $ $ $ x$ x$ $ A$ A$ b}$~ _#  #S Ni# #ȯ X$ $ u$ uNC$ȯ 21$ p$ȯ ^$ O6$&) $&) O63$ T3$ =nM$ =n$ h$ h$&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&''''''''' ' ' ' ' ''''''''''''''''''' '!'"'֍$ 7?  D? $'#'#'%'֍$ O"  " ''&'&'('֍$ :)  `:) *')')'+'֍$  L*  ` L* -',','.'֍$ !  J! 0'/'/'1'֍$ Dtb% 0ytb% 0y$3% D$3%3'2'2'2'2'4'5'6'֍$ Q$ Q"$ "$ $ $ $ $ $ $ $lk Z%a  %  % &2% V>% rc% rc% V>% &2% \% 0\% 6&  0^& ~& )& & & 'ȯ v3' vg) # u+) f) )C )C `) f`) u-* # v* vS*` zis*i * |h<*  <* 8*h ڿs*_ nS* n*H )H n) nq)H l)H ng) nh?'  'ng N& j)& j~& N0^&ye K& Z&g 0^& ,~& ,)& &  u& h)& h~& u0^&t #F2& W$ȯ $ $ $ H$ HL$ 2L$1 r}$+ 3$ H$ H}$ }$ $ $ J$ PJ$ P$8'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'7'9':';'<'='>'?'@'A'B'C'D'E'F'G'H'I'J'K'L'M'N'O'P'Q'R'S'T'U'V'W'X'Y'Z'['\']'^'_'`'a'b'c'd'e'f'g'h'i'j'k'l'm'n'o'p'q'r's't'u'v'w'x'y'z'{'|'}'~''''''''''''''''֍$ \ZM& \& D& DZM&''''''''֍$ \& \N]' DN]' D&''''''''֍$ \f' \' D' Df'''''''''֍$ \:' \v( Dv( D:'''''''''֍$ dbL&  ȯL& ''''֍$ :)  :) ''''֍$ ;  ; ''''֍$ `"  " ''''֍$  *  " * ''''֍$ F6$ 6$ x{$ Fx{$''''''''֍$ -++  ++ ''''֍$ Pa0!  0! ''''֍$ |wh#  h# ''''֍$ Tt;#  X|t;# ''''֍$ d,)(  &,)( ''''֍$ X$  dX$ ''''֍$ P)' Jj *  j *W M) M) Ч) Ч) ) O) R'O) R'K* UY*(3 "s* ,* "<*W * 8*ȯ jF* `*ȯ * O) O) ) Ч) Ч) M) M) Ϧ) Ϧ) 3u) 3u) ) ) 3u) 3u) [p) P)  OP) a[p) a3u) ~Y3u) ~Yͧ) ~Y) ~YO) aO) a|* 0* * ,*D i* )̀* ^Ha*ȯ NS* NO) vVO) vV) vVͧ) vV3u) 3u) ) ) 3u) r3u) r[p) %P)  bP) ) 3u) N3u) NϦ) PϦ)''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''((((((((( ( ( ( ( (((֍$ 1q% % :% :zB& N0^& 2~& 2)& N&  & )& ~& 0^& zB& % t3%8 }%w ~v% S% iaA%< ct/%  t/%>(((((((((((((((((((((((((((((((((((( (!("(#($(%(֍$ rR  ֟ '(&(&(((֍$ d  =d *()()(+(֍$ d!  =d! -(,(,(.(֍$ ^X$  LX$ 0(/(/(1(֍$ \&  K& 3(2(2(4(֍$ \l(  Kl( 6(5(5(7(֍$ \<)  K<) 9(8(8(:(֍$ ++  h]++ <(;(;(=(6$5,$5,̍LA( ) R) ʨe) ʨ?y) xi)ȯ Rc) oc) `y)\,̍LG) G4, G&!,H)H)J)6F)G4,E)G4,̍LN) G( 5(O)O)Q)6M)G(L)G(̍LU) l Y$ F Y$V)V)X)6T)l Y$S)l Y$̍L\) h$ x{$])])_)6[)h$Z)h$̍Lc) f Y$  Y$d)d)f)6b)f Y$a)f Y$̍Lj) vI$ 6$k)k)m)6i)vI$h)vI$̍Lq) Gm% !m%r)r)t)6p)Gm%o)Gm%̍Lx) [% [%y)y){)6w)[%v)[%̍L) om% m%)))6~)om%})om%̍L) %% %%)))6)%%)%%̍L) %% %%)))6)%%)%%̍L) J% J%)))6)J%)J%̍L) ƿP% ƿrc%)))6)ƿP%)ƿP%̍L) J% J%)))6)J%)J%̍L) ~it;# X|t;#)))6)~it;#)~it;#̍L) V# Vv#)))6)V#)V#̍L) .t;# Tt;#)))6).t;#).t;#̍L) VL" Vr")))6)VL")VL"̍L) RX$ dX$)))6)RX$)RX$̍L) VT$ V.$)))6)VT$)VT$̍L) X$ X$)))6)X$)X$̍L) V%$ V $)))6)V%$)V%$̍L) Yv* Yv*)))6)Yv*)Yv*̍L) h * V *)))6)h *)h *̍L) Yv * YvF*)))6)Yv *)Yv *̍L) N4<& (4<&)))6)N4<&)N4<&̍L) f Q& fc&))*6)f Q&)f Q&̍L* ~^4<& K4<&***6*~^4<&*~^4<&̍L *  *  * * **6 * * * *̍L*  * z ****6* ** *̍L* 2&* &****6*2&**2&*̍L * )* <*!*!*#*6*)**)*̍L'* &* 8&*(*(***6&*&*%*&*̍L.* 2 *  */*/*1*6-*2 *,*2 *̍L5*  * 8 *6*6*8*64* *3* *̍L<* ++ ++=*=*?*6;* ++:* ++̍LC* |k+ V~+D*D*F*6B*|k+A*|k+̍LJ* Bp++ h]++K*K*M*6I*Bp++H*Bp++̍LQ* * *R*R*T*6P**O**̍LX* ++ -++Y*Y*[*6W*++V*++̍L_* V|k+ VV~+`*`*b*6^*V|k+]*V|k+̍Lf* ++ ++g*g*i*6e*++d*++̍Lm* V* V*n*n*p*6l*V*k*V*̍Lt* <* <*u*u*w*6s*<*r*<*̍L{* * j*|*|*~*6z**y**̍L* V{<* |h<****6*V{<**V{<*̍L* j& D&***6*j&*j&̍L* Խ& &***6*Խ&*Խ&̍L* o& \&***6*o&*o&̍L* 4`& ZM&***6*4`&*4`&̍L* j' D'***6*j'*j'̍L* tJ' N]'***6*tJ'*tJ'̍L* o' \'***6*o'*o'̍L* & &***6*&*&̍L* jD' DD'***6*jD'*jD'̍L* ' '***6*'*'̍L* oD' \D'***6*oD'*oD'̍L* ty' f'***6*ty'*ty'̍L* j4( D4(***6*j4(*j4(̍L* c( v(***6*c(*c(̍L* o4( \4(***6*o4(*o4(̍L* ( :'***6*(*(̍L* >) )***6*>)*>)̍L+ ) *+++6*)*)̍L+ f) )++ +6+f)+f)̍L+ ) +)+++6 +) +)̍L+ /]8* /7K*+++6+/]8*+/]8*̍L+ >'* d'*+++6+>'*+>'*̍L#+ /I* /o*$+$+&+6"+/I*!+/I*̍L*+ + ϭ+++++-+6)++(++̍L1+  , #,2+2+4+60+ ,/+ ,̍L8+ k+ +9+9+;+67+k+6+k+̍L?+ I+ #+@+@+B+6>+I+=+I+̍LF+  , #,G+G+I+6E+ ,D+ ,̍LM+ k+ +N+N+P+6L+k+K+k+̍LT+ I+ w\+U+U+W+6S+I+R+I+̍L[+ L2 , L2#,\+\+^+6Z+L2 ,Y+L2 ,̍Lb+ L2k+ L2+c+c+e+6a+L2k+`+L2k+̍Li+ + ˳+j+j+l+6h++g++̍Lp+  , #,q+q+s+6o+ ,n+ ,̍Lw+ Or+ u_+x+x+z+6v+Or+u+Or+̍L~+ k+ ++++6}+k+|+k+̍L+ Z0% 40%+++6+Z0%+Z0%̍L+ o<& o&+++6+o<&+o<&̍L+ X0% E0%+++6+X0%+X0%̍L+ o$% oJ%+++6+o$%+o$%̍L+ Z}$ 4}$+++6+Z}$+Z}$̍L+ oĢ$ o$+++6+oĢ$+oĢ$̍L+ X}$ E}$+++6+X}$+X}$̍L+ oX$ oE$+++6+oX$+oX$̍L+ ) )+++6+)+)̍L+ Ƴs) ƳM)+++6+Ƴs)+Ƴs)̍L+ ک) )+++6+ک)+ک)̍L+  ) )+++6+ )+ )̍L+ s) M)+++6+s)+s)̍L+ *) P)+++6+*)+*)̍L+ .S F+ f F++++6+.S F++.S F+̍L+ ;l]+ ;Fp++++6+;l]++;l]+̍L+ n$ F+  F++++6+n$ F++n$ F+̍L+ ;.+ ;++++6+;.++;.+̍L, R# e#,,,6,R#,R#̍L , b;# b;µ# , , ,6 ,b;#,b;#̍L, $# (#,,,6,$#,$#̍L, b;(t# b;Na#,,,6,b;(t#,b;(t#̍L, v,# P,# , ,",6,v,#,v,#̍L&, # f#',',),6%,#$,#̍L-, ,# ܂,#.,.,0,6,,,#+,,#̍L4, ̬# #5,5,7,63,̬#2,̬#̍L;, &:) :)<,<,>,6:,&:)9,&:)̍LB, ƿQ) ƿd)C,C,E,6A,ƿQ)@,ƿQ)̍LI, f:) :)J,J,L,6H,f:)G,f:)̍LP, ƿ<#) ƿb)Q,Q,S,6O,ƿ<#)N,ƿ<#)̍LW, wGj$ Gj$X,X,Z,6V,wGj$U,wGj$̍L^, cGj$ PGj$_,_,a,6],cGj$\,cGj$̍Le, m\$ mJ$f,f,h,6d,m\$c,m\$̍Ll, @> Qm,m,o,6k,@>j,@>̍Ls, " "t,t,v,6r,"q,"̍Lz,  *{,{,},6y,x,̍L, " ",,,6,","̍L,  r,,,6,,̍L, z z,,,6,z,z̍L, \ ,,,6,\,\̍L, z z,,,6,z,z̍L, lO FO,,,6,lO,lO̍L, Nnq Nn,,,6,Nnq,Nnq̍L, 0LO V9O,,,6,0LO,0LO̍L, l ( ` (,,,6,l (,l (̍L, 6&& 9&,,,6,6&&,6&&̍L, ^l' ^F',,,6,^l',^l'̍L, & &,,,6,&,&̍L, ^& ^&,,,6,^&,^&̍L, h# h#,,,6,h#,h#̍L, ,@# ,$,,,6,,@#,,@#̍L, Th# |wh#,,,6,Th#,Th#̍L, ,# ,#,,,6,,#,,#̍L, f- ^Dw& ^jd&?-?-A-6=-^Dw&<-^Dw&̍LE- &,* ,*F-F-H-6D-&,*C-&,*̍LL- Nz1* NzC*M-M-O-6K-Nz1*J-Nz1*̍LS- vf,* S,*T-T-V-6R-vf,*Q-vf,*̍LZ- NzT * Nzz)[-[-]-6Y-NzT *X-NzT *̍La- ^$R' ^$~e'b-b-d-6`-^$R'_-^$R'̍Lh- >' >'i-i-k-6g->'f->'̍Lo- ^$*' ^$'p-p-r-6n-^$*'m-^$*'̍Lv- 68m% Km%w-w-y-6u-68m%t-68m%̍L}- ^$́% ^$%~-~--6|-^$́%{-^$́%̍L- m% m%---6-m%-m%̍L- ^$Z% ^$BG%---6-^$Z%-^$Z%̍L- L& ȯL&---6-L&-L&̍L- $& ,&---6-$&-$&̍L- >uL& dbL&---6->uL&->uL&̍L- t% %---6-t%-t%̍L- T<\& g<\&---6-T<\&-T<\&̍L- @p& @&---6-@p&-@p&̍L- -<\& D<\&---6--<\&--<\&̍L- @dH& @5&---6-@dH&-@dH&̍L- ҃# #---6-҃#-҃#̍L- o`# o:#---6-o`#-o`#̍L- "\# HI#---6-"\#-"\#̍L- ow# od#---6-ow#-ow#̍L- 8X$ LX$---6-8X$-8X$̍L- %tl$ %L$---6-%tl$-%tl$̍L- 6X$ ^X$---6-6X$-6X$̍L- %D$ %0$---6-%D$-%D$̍L. 8& K&...6.8&.8&̍L . %t& %N& . . .6.%t&.%t&̍L. 6& \&...6.6&.6&̍L. %ĵ& %&...6.%ĵ&.%ĵ&̍L. 8l( Kl(..!.6.8l(.8l(̍L%. %D( %(&.&.(.6$.%D(#.%D(̍L,. 6l( \l(-.-./.6+.6l(*.6l(̍L3. %( %(4.4.6.62.%(1.%(̍L:. 8<) K<);.;.=.69.8<)8.8<)̍LA. %) %)B.B.D.6@.%)?.%)̍LH. 6<) \<)I.I.K.6G.6<)F.6<)̍LO. %d) %)P.P.R.6N.%d)M.%d)̍LV. j * j *W.W.Y.6U.j *T.j *̍L]. B * 3*^.^.`.6\.B *[.B *̍Ld. $j * Jj *e.e.g.6c.$j *b.$j *̍Lk. :) `:)l.l.n.6j.:)i.:)̍Lr. tN) Na)s.s.u.6q.tN)p.tN)̍Ly. ֵ:) :)z.z.|.6x.ֵ:)w.ֵ:)̍L. &) )...6.&)~.&)̍L.  L* ` L*...6. L*. L*̍L. _* r*...6._*._*̍L. ֵ L*  L*...6.ֵ L*.ֵ L*̍L. 48* Z%*...6.48*.48*̍L. f\+ @1\+...6.f\+.f\+̍L. 4#+ 6+...6. 4#+. 4#+̍L. \+ \+...6.\+.\+̍L. * *...6. *. *̍L. Y+ Y+...6.Y+.Y+̍L. lm+ F+...6.lm+.lm+̍L. Y+ ,Y+...6.Y+.Y+̍L. E+ 2+...6.E+.E+̍L. ?* R*...6.?*.?*̍L. + + ++...6.+ +.+ +̍L. * 4*...6.*.*̍L. +* +:*...6.+*.+*̍L. \'% o'%...6.\'%.\'%̍L. I|;% IVN%../6.I|;%.I|;%̍L/ 65'% \"'%///6/65'%/65'%̍L / I% I% / //6 /I% /I%̍L/ E& tX&///6/E&/E&̍L/ 1& 1α&///6/1&/1&̍L!/ &  &"/"/$/6 /&/&̍L(/ 1Dw& 1jd&)/)/+/6'/1Dw&&/1Dw&̍L// ,)( &,)(0/0/2/6./,)(-/,)(̍L6/ =( O(7/7/9/65/=(4/=(̍L=/ >,)( d,)(>/>/@/6,)(;/>,)(̍LD/ T( z(E/E/G/6C/T(B/T(̍LK/  * " *L/L/N/6J/ *I/ *̍LR/ 0* 0д*S/S/U/6Q/0*P/0*̍LY/ X *  *Z/Z/\/6X/X *W/X *̍L`/ 0Hy* 0pe*a/a/c/6_/0Hy*^/0Hy*̍Lg/ " "h/h/j/6f/"e/"̍Ln/ " r"o/o/q/6m/"l/"̍Lu/ " F"v/v/x/6t/ "s/ "̍L|/ r" `"}/}//6{/r"z/r"̍L/ fu! yu!///6/fu!/fu!̍L/ Rȉ! R!///6/Rȉ!/Rȉ!̍L/ ?u! 6,u!///6/?u!/?u!̍L/ Rb! R>O!///6/Rb!/Rb!̍L/ 0i  0i ///6/0i /0i ̍L/ Ҵ}  Ҵ ///6/Ҵ} /Ҵ} ̍L/ 0i  0i ///6/0i /0i ̍L/ ҴXU  Ҵ~B ///6/ҴXU /ҴXU ̍L/ [" n"///6/["/["̍L/ H" Hj"///6/H"/H"̍L/ .4" T!"///6/.4"/.4"̍L/ Hp" H^"///6/Hp"/Hp"̍L/ s! s!///6/s!/s!̍L/ ! !///6/!/!̍L/ s! Ds!///6/s!/s!̍L/ `! 6M!///6/`!/`!̍L/ c(g  v(g ///6/c(g /c(g ̍L/ O{  Oڍ ///6/O{ /O{ ̍L0 <(g  .)(g 00060<(g /<(g ̍L0 OPS  Ov@  0 0 060OPS 0OPS ̍L0  "  "00060 " 0 "̍L0 " "00060 "0 "̍L0 4 " Z "00 0604 "04 "̍L$0 2" X"%0%0'06#0 2""0 2"̍L+0 ~! ~!,0,0.06*0~!)0~!̍L20 ҜV! Ҝ0!303050610ҜV!00ҜV!̍L90 ~! v~!:0:0<0680~!70~!̍L@0 Ҝ! Ҝp!A0A0C06?0Ҝ!>0Ҝ!̍LG0 82  E H0H0J06F082 E082 ̍LN0 `  `b O0O0Q06M0` L0` ̍LU0    V0V0X06T0  S0  ̍L\0 `z  `g ]0]0_06[0`z Z0`z ̍Lc0 >" "d0d0f06b0>"a0>"̍Lj0 fv" fv"k0k0m06i0fv"h0fv"̍Lq0 b" O"r0r0t06p0b"o0b"̍Lx0 fvD" fvj"y0y0{06w0fvD"v0fvD"̍L0 8! J!0006~08!}08!̍L0 :$h! :$B!00060:$h!0:$h!̍L0 b! !00060b!0b!̍L0 :${! :$h!00060:${!0:${!̍L0 jr?  D? 00060jr? 0jr? ̍L0 ^nS  ^Hf 00060^nS 0^nS ̍L0 J?  7? 00060J? 0J? ̍L0 ^+  ^ 00060^+ 0^+ ̍L0 " "00060"0"̍L0 " "00060"0"̍L0 :" `"00060:"0:"̍L0 (" N"00060("0("̍L0 ڛ0! 0!00060ڛ0!0ڛ0!̍L0 ! !00060!0!̍L0 *t0! Pa0!00060*t0!0*t0!̍L0 X! ~!00060X!0X!̍L0 <;  ; 00060<; 0<; ̍L0 dO  db 00060dO 0dO ̍L0 ;  ; 00160; 0; ̍L1 d'  d$ 11161d' 1d' ̍L 1 +d  =d  1 116 1+d 1+d ̍L1 :<  :/ 11161:< 1:< ̍L1 bd  d 11161bd 1bd ̍L 1 : :!1!1#161:1:̍L'1 +d! =d!(1(1*16&1+d!%1+d!̍L.1 :-E-L-S-Z-a-h-o-v-}-------------------. ....%.,.3.:.A.H.O.V.].d.k.r.y..................../ ///!/(///6/=/D/K/R/Y/`/g/n/u/|///////////////////00000$0+02090@0G0N0U0\0c0j0q0x000000000000000000001 111 1'1.151<1C1J1Q1X1`1 ^, ^< < ,b1a1a1a1a1c1d1e1^`1q#*18?FMT[bipw~ &-4;BIPW^elsz ")07>ELSZahov}    % , 3 : A H O V ] d k r y ! !!!!!(!/!6!=!D!K!R!Y!`!g!n!u!|!!!!!!!!!!!!!!!!!!!"""""$"+"2"9"@"G"N"U"\"c"j"q"x""""""""""""""""""""# ### #'#.#5#<#C#J#Q#X#_#f#m#t#{###################$$$$$#$*$1$8$?$F$M$T$[$b$i$p$w$~$$$$$$$$$$$$g1 c ^c ^, ,i1h1h1h1h1j1k1l1^g1$+29@GNU\cjqx  '.5<CJQX_fmt{#*18?FMT[bipw~ &-4;BIPW^elsz ")07>ELSZahov} %,3:AHOV]dkry !(/6=DKRY`gnu|$+29@GNU\cjn1 O ^O ^, ,p1o1o1o1o1q1r1s15t^n1 :AHOV]dkry !(/6=DKu1 ,, B5, B5) ,)w1v1v1v1v1x1y1z1LRGNE{1{1{1$1&1)&1+&1-&1/1 "21$1&1)&1+&1-&1/1SMC04027191;1=111=122L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2C - 0402B1D1C9C:\Users\Public\Documents\PCB Artist\Library\Discrete.sslLRCLRC18F11^-Һ%H2C0402JL1{1 p.LpL $TLpL $TLL p.LL11111111TVX1JAL'L[\]1_1b_LEL _1dJAL'L@X1JALZL[\]1_1b_L[xL _1dJALZL@]1_1LLTJALJALL8c8cl1n11p111LRVDE111$1&1)&1+&1-&1/1 "21$1&1)&1+&1-&1/1USERcc111137191;1$=111=122=133=144=155=166=177=188=199=11010=11111=11212=11313=11414=11515=11616=11717=11818=11919=12020=12121=12222=12323=12424=12525=12626=12727=12828=12929=13030=13131=13232=13333=13434=13535=13636L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl LRU1F11 /f% p11]1_1d$.p$@_1b$.1$ 111$8.$]1_1d$8.p$@_1b$8.1$ 1]1_1dK.p$@_1bK.1$ 1]1_1d4_.p$@_1b4_.1$ 1N05201112\30>(ZVia_12\30>(1$2&2)&2+&2-&2/1 "2 2$2&2)&2+&2-&2/1SMC04027292;2=211=222L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2R - 0402B2D2R5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRRLRR14F22 M2H+1l2n21p22N0550"2"2!2"2$(2&(2)&(2+&(2-&(2/1 "2.2$/2&/2)&/2+&/2-&/2/1USERLED_BANK7/29/2;62=6211=6222=6233=6244=6255=6266=6277=6288}+M5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2 4 Led BankB@2D@2LED Bank5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRLEDLRLED1F(2'21 ,Sp'2&2'2{1E21 ,Z]E2_E2d2V+@_E2b2', '2N0553L2L2L2$R2&R2)&R2+&R2-&R2/1 2LRR15FR2Q2r1M+1lQ2nQ21pQ2P2Q2N0517^2^2^2a20W'2a20W']2`20W'0(p1v_*p1U.+r1S/+r1I4+c2Kc2Kc2Kc2Kc2Kc2Ke2f2g2h2i2K^2^21k2$]l2_l2dD.p$@_l2bD.1$ D.$^2p2.$2p2.$j2D.$l.$.$r2Kr2Kr2Kt2u2K^2p2a2v2.$:.$0&0V'0W'w2Kw2Kw2Kw2Kw2Ky2z2{2|2KG^2p2a2]2k2J\2r1I4+1]\2_\2b61 R+ _\2dr1I4+@]Q2_Q21*_T O21]P2_P2b61+ _P2dr1f+@r1f+K2N2r1f+r1 ,2K2K2KGL2O2K2JJ2r1 ,^]J2_J2d61V+@_J2b61', '2{12:B1 ,b]2_2d_1V+@_2b_1', '2{120 ,f]2_2dR0V+@_2bR0', '2N0552222$2&2)&2+&2-&2/1 2LRR16F220N+1l2n21p222N051822220dh*220dh*220dh*0M2+0G5+2K2K2K22K2212(]2_2d̙.p$@_2b̙.1$ ̙.$22T/$22T/$2̙.$.($B.ڸ$@C/ڸ$T/$2K2K2K2K2K2222K22220dh*0fo&T/$2K2K2K22KG22222J20G5+1]2_2b1 S+ _2d0G5+@]2_2L91(*_T 21]2_2b1+ _2d0g+@0g+220g+0 ,2K2K2KG222J20 ,j]2_2d1V+@_2b1', '2N0551222$2&2)&2+&2-&2/1 2LRR17F22S0U+1l2n21p222N05192222W0X*22W0X*22W0X*W0A8+S09<+2K2K2K22K2212,]2_2dT.p$@_2bT.1$ T.$22/$22/$2T.$|.t$F.$/$2K2K2K2K223K2223/$/$b2/$k08&k0X*W0X*3K3K3K3K3K3K33333KG22222J2S09<+1]2_2bp0Y+ _2dS09<+@]2_2t0h)_T 21]2_2bp0+ _2dS0n+@S0n+22S0n+S0 ,T0 ,3K3K3K33KG222J2T0 ,n]2_2dq0V+@_2bq0', '2{13/ ,r]3_3d0V+@_3b0', %2U]&2_&2dk2V+@_&2bk2', N2 ,$2 M2a+ M2 ,N2 ,"3K"3K"3K$3%3KG"2!2%2J 2 M2a+1] 2_ 2bj2+ _ 2d M2a+@2]2_22*_T 21]2_2bj2M+ _2d M2S/+@ M2S/+2\30>(h-0>(h-0(O2*O2W-+ M2S/+/3K/3K/3K/3K/3K/3K1323334353K11173n.$273n.$63r.$r.$n.$93K93K93K;3<3K1732=3n.$n.$z.$H.$/&/'0>(\30>(>3K>3K>3K>3K>3K>3K>3K>3K@3A3B3C3D3E3F3KG173221J1r.$ ]1_1dr.p$@_1br.1$ l22210]K3_K3d.p$@_K3b.1$ 1N0547Q3Q3P3Q3$W3&W3)&W3+&W3-&W3/1 2LRR9FW3V3R:/p$1lV3nV31pV3V3N0516c3c3c3f34)2f34)c3$k3&k3)&k3+&k3-&k3/1 2LRR10Fk3j3 4>})1lj3nj31pj3i3j31u3 4c)1]u3_u3b4) _u3d 4c)@]j3_j3R4*)T h31]i3_i3b4O) _i3d 4)@ 4)e34)4) 4)3K3K3K33Kc3b3c33h/z$23h/z$3S/p$r/p$h/z$3K3K3K33Kc33f33h/z$/z$4)3K3K3K33Kc3h3c3$3&3)&3+&3-&3/1 "23$3&3)&3+&3-&3/1USERUSB_B_F7393;3=311=322=333=344=355=366:L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2 USB ConnectorB3D3 USB ConnectorVBUSD-D+GNDShieldShield5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRUSBLRUSB1F33P14*5p33{13x5/+7]3_3d<:5+@_3b<:5M+ 3{13(F3/+<]3_3dc3+@_3bc3M+ 33E]3_3d@4"Z*@_3b@4* 3{13|4*I]3_3d@4B*@_3b@4* 3N05153333t4)23t4)33t4)t4Be*$b4w*3K3K3K33K33$3&3)&3+&3-&3/1 2LRR8F33R:/"%1l3n31p333N0546333138]3_3d/0%@_3bfP/0% .0%33.0%I/.%!/"%3K3K3K33KG333J3!/"%1]3_3b>/1% _3d!/"%@]3_3/p$T_31]3_3bcq/1% _3dS/"%@S/"%33F/6 %23F/6 %3S/"%Z/"%F/6 %3K3K3K33K3333F/6 %F/4 %t4)3K3K3K33KG33333J3$b4w*M]3_3d4"Z*@_3b4* 3@]3_3d4B*@_3b4* $b4*3 4) 4 `*$b4*4K4K4K44KGc33f3h3b33Ja3S/p$1]a3_a3bcq/4 % _a3dS/p$@U3]V3_V3/$T_T31]U3_U3b>/4 % _U3d!/p$@!/p$S3.%.V%/\$/\$!/p$4K4K4K4K4K4444KGQ3P3T3JO3.%4]O3_O3d/%@_O3bfP/% 3114.D%<]4_4d/D%@_4bfP/D% 1@]4_4d/W%@_4bfP/W% 1N0521%4%4%4(4f-8)2(4f-8)%4$-4&-4)&-4+&-4-&-4/1 "234$44&44)&44+&44-&44/1USERCC1190744944;;4=;411=;422=;433=;444=;455=;466=;477=;488=;499=;41010=;41111=;41212=;41313=;41414=;41515=;41616YL5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2CC1190BM4DM4CC1190GNDPA_OUTGNDTR_SWLNA_INHGMLNA_ENPA_ENGNDLNA_OUTPA_INGNDVDD_LNABIASVDD_PA2VDD_PA15C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslULRU2F-4,4*-1)H2CC1190JLQ4{S4 Y|&;' j';' j'& )&& Y|&ŵ&U4T4T4T4T4T4V4W4X4Y4TLQ4{Z4 4&'&  &'& \4[4[4]4TLQ4{^4 )&k' b'k' b'ŵ& )&ŵ&`4_4_4_4_4a4b4c4VXQ4f&&ZPS1_2_1.\]e4_e4df&I&@_e4bf& & XQ4&&f4\]j4_j4d&I&@_j4b& & XQ4.'&f4\]n4_n4d.'I&@_n4b.' & XQ4'&f4\]r4_r4d'I&@_r4b' & XQ4?'&f4_\]v4_v4dp'&@_v4ba'& XQ4?'f'f4_\]z4_z4dp'f'@_z4ba'f' XQ4?'1'f4_\]~4_~4dp'1'@_~4ba'1' XQ4?'.K'f4_\]4_4dp'.K'@_4ba'.K' XQ4'Cq'f4 \]4_4d'2'@_4b''  XQ4.'Cq'f4 \]4_4d.'2'@_4b.''  XQ4&Cq'f4 \]4_4d&2'@_4b&'  XQ4f&Cq'f4 \]4_4df&2'@_4bf&'  XQ4Q&.K'f4\]4_4dx.&.K'@_4b%.K'  XQ4Q&1'f4\]4_4dx.&1'@_4b%1' XQ4Q&f'f4\]4_4dx.&f'@_4b%f' XQ4Q&&f4\]4_4dx.&&@_4b%& XQ4& 9'ZStyle3`T\]4_4d&'@_4b&' XQ4' 9'4\]4_4d''@_4b'' XQ46&'4\]4_4d6&X'@_4b6&r' XQ4h''4\]4_4dh'X'@_4bh'r' ]Q4_Q4)&9'Tb'D&'jM8c8cl,4n,4S4n,4Z4n,4^4p,4,4{14e.-)e4]4_4de.(@_4be.޲( ,4N0522444$4&4)&4+&4-&4/11LRC1F44:H.-*1l4n41p444N0525444$4&4)&4+&4-&4/1 "24$4&4)&4+&4-&4/1SMC04027494;4=411=422UL5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2L - 0402B4D4L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRLLRL3F44>F.̳*1l4n41p44N0526444$4&4)&4+&4-&4/14LRL4F44p-.(+1l4n41p44N0527 5 5 5$5&5)&5+&5-&5/11LRC7F55-O+1l5n51p55{15-O+1]5_5bM-Vm+ _5d-O+@5]5_5,/+T 51]5_5b1.Vm+ _5d#.O+@#.O+ 5$'5&'5)&'5+&'5-&'5/1 "2-5$.5&.5)&.5+&.5-&.5/1USERSMA_RP7.59.5;55=5511=5522=5533=5544=5555L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2SMAB<5D<5SMA5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslCONNCONN1F'5&5.,, p&5&5{1A5w.dd, ]A5_A5d.F,@_A5b.(, %5&5{1F5w.+ ]F5_F5d.0+@_F5b.+ &5{1K5j-+ ]K5_K5d.-0+@_K5b.-+ &5{1P5j-dd, ]P5_P5d.-F,@_P5b.-(, ]&5_&5.:+T$5 ]%5_%5df2.h+@_%5bf2., .,, 5#.O+#.,.,,Z5ÀRFZ5^5Z5^5\5]5^5 5 5 5_5#.O+#.(+`5^5`5^5b5^5G 5 5$5 5IRF^5^5M5#.(+1]5_5b1.F+ _5d#.(+@4]4_4s.+T41]4_4bd.F+ _4dF.(+@F.(+4$p5&p5)&p5+&p5-&p5/11LRC6Fp5o5 _.D*1lo5no51po5o5{1z5Yx.D*1]z5_z5b.+ _z5dYx.D*@n5]o5_o5l-x*T_m51]n5_n5bc.+ _n5dE.D*@E.D*4F.(+F.B*E.D*5^55^55^555^54m545E.D*E.*>F.*5^55^55^555^5G44m54d54>F.*1]4_4bd.* _4d>F.*@4]4_4w-*T 41]4_4bd.C* _4d>F.*@>F.*4 "25$5&5)&5+&5-&5/1USERC04027595;5=511=522QL5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl1LRC5F55r,.Rq*1l5n51p55{15%.Rq*1]5_5b0.* _5d%.Rq*@5]5_5r.-~[*T51]5_5bc.* _5dE.Rq*@E.Rq*4>F.*>F.q*E.Rq*5K5K5K55K4545E.Rq*E.I*:H.'G*5K5K5K55K444$5&5)&5+&5-&5/14LRL2F55.G*1l5n51p55N05245555$5&5)&5+&5-&5/11LRC2F55-**1l5n51p55N05235555$5&5)&5+&5-&5/11LRC4F55,-)1l5n51p55{15߶-)1]5_5b-v) _5d߶-)@5]5_5r,.d)T51]5_5b=.v) _5dy-)@y-)5-)-1)y-)5K5K5K55K555$6&6)&6+&6-&6/11LRC3F66^-@|)1l6n61p66N0528 6 6 6,46v4]6_6dz$.Y)@_6bEK.Y) -Y) 66-Y)g-X)^-b)6K6K6K66KG 66 6J 6^-b)1] 6_ 6b"-) _ 6d^-b)@5]6_6,U)T51]5_5b"-Q) _5d^-)@^-)5y-)-)^-)"6K"6K"6K$6%6K55,4'6r4](6_(6d.(@_(6b.޲( .-)5&6.-)4.)y-),6K,6K,6K.6/6KG5555'6J5-)1]5_5b. * _5d-)@5]5_5-Z)T51]5_5b.;=* _5d-w*@-w*5y-G*y-*-w*96K96K96K;6<6KG555J5y-G*1]5_5b=.je* _5dy-G*@5]5_5-,*T51]5_5b9.je* _5d.G*@.G*5:H.'G*.'G*.G*F6KF6KF6KH6I6KG44545J4:H.'G*1]4_4be.d* _4d:H.'G*@]4_4.*_T41]4_4be.Q2* _4d:H.*@:H.*4$V6&V6)&V6+&V6-&V6/1 "2\6$]6&]6)&]6+&]6-&]6/1SMC06037]69]6;d6=d611=d622xL5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2L - 0603Bh6Dh6L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRLLRL1FV6U6k.t)H2C0603JLl6{n6 -T}WT 4T}WT 4TsS -TsSp6o6o6o6o6q6r6s6TVXl6xTSZPS1_4_1'*\]u6_u6b<8TT _u6dxTS@Xl6xT2=Tv6\]z6_z6b<8TZT _z6dxT2=T@]l6_l6US#TTxTxT2L8c8clU6nU6n6pU6T6U616.t)z6]6_6bp.8) _6d.t)@]U6_U6b.*_TS6u6]T6_T6bf.8) _T6d8I.t)@8I.t)4:H.*:H.r)8I.t)6K6K6K66K44S66hL.-)L.)8I.t)6K6K6K66KG44S64J4hL.-)j4]4_4dhL.(@_4bhL.޲( ,4{163.-)n4]6_6d3.(@_6b3.޲( (66,4N051366616L]6_6d/8%@_6bfP/8% .8%66&/#26&/#6.8%>.$%(/$% 0#% 0$&/"E$&/#6K6K6K6K6K6K6K666666K666$6&6)&6+&6-&6/1 "26$6&6)&6+&6-&6/1USER 2x5 header7696;6 =611=622=633=644=655=666=677=688=699=61010}8M5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2 2x5 HeaderB6D6 2x5 Pinrow 5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRHeader LRHeader1F66.3$H2 2x5 headerJL66 ;n' <n' <E) ;E)66666666TVX6.<)Z Style1_2_11\]6_6d9< )@_6b9<O) X6@.<(6\]6_6d*9<Ұ(@_6b*9<Z( X6-<'6\]6_6d8<*'@_6b8<' X6x-<X(6\]6_6db8<M(@_6bb8<"( X6@.<L'6\]6_6d*9<b'@_6b*9<%( X64;)6\]6_6d;)@_6b;.O)  X6; X(6\]6_6d;6M(@_6b;( X6Ѐ;X(6\]6_6d;n(@_6b;(  X6l;'6\]6_6dV;Ɔ'@_6bV;N' X6Ѐ;'6\]7_7d;'@_7b;%( ;Xj)d8M8c8cl6n66p66N0542 7 7 717]7_7d-0%@_7bZ-0% b.0% 77b.0%-.%J-:%J-$#._$._$:. "$>.#7K7K7K7K7K7K7K7K7777777KG 77 7J 7>.#6] 7_ 7d(/#@_ 7b(/ $ 6N0512#7#7#71&7H]'7_'7d/~%@_'7bfP/~% .~%#7+7`/< $2+7`/< $%7.~%>.H%/H%/Z %/$`/U$`/< $-7K-7K-7K-7K-7K-7K-7K/70717273747K#7+7"757`/< $`/#/B#.F#.J#67K67K67K67K67K8797:7;7K#7#7=7Ȃ-( )2=7Ȃ-( )#7,4?7~4]@7_@7dz$.P&)@_@7bEK.P&) -P&)<7Ȃ-( )-$)-$)-P&)D7KD7KD7KD7KF7G7H7K#7+7=7I7`/< $@C/< $0.L$.L$-"%-H(Ȃ-@(Ȃ-( )J7KJ7KJ7KJ7KJ7KJ7KJ7KJ7KL7M7N7O7P7Q7R7KG#7+7=7&7"7?7J!7.J#6]!7_!7d/`z#@_!7b/# 6{1W7v.["6]W7_W7d`/P"@_W7b`/@" 661\7.ھ"6]\7_\7d/"@_\7b/x" 6N0543c7c7b7c71f7]g7_g7d-(k%@_g7bZ-(k% b.(k%e7J.#j0.${-${-$%&-tj%.tj%b.(k%k7Kk7Kk7Kk7Kk7Kk7Kk7Km7n7o7p7q7r7KGc7b7f7Ja7J.#6]a7_a7dU.4#@_a7bU.$ 6N0514y7y7y71|7]}7_}7d-W%@_}7bZ-W% b.W%y77-$27-${7b.W%.X%-X%-2 %-$7K7K7K7K7K7777Ky7x7y77-5#27-5#7I.!#- $#r- $#-5#7K7K7K7K777Ky7777-$->$-< $-^#-5#-5#7K7K7K7K7K7K77777KGy777|7x7Jw7I.!#6]w7_w7dT.#@_w7bT.LR# 6N0544777$7&7)&7+&7-&7/1 2LRR7F77(-D#1l7n71p7717۸-D#1]7_7b-# _7d۸-D#@7]7_7<,\#T71]7_7b9 .# _7du-D#@u-D#77u-D#h.D#jJ.#7K7K7K77KG777J7jJ.#6]7_7dTU.y#@_7bTU.# 6N054077717]7_7d-D%@_7bZ-D% b.D%77b.D%-fB%h-(%h-޶$z(.@$h.@$.>$.>#.g"J.g"J.>["7K7K7K7K7K7K7K7K7K7K7K7777777777KG777J7J.>["6]7_7dT.TP"@_7bT.܋" 6N054177717]7_7d-~%@_7bZ-~% b.~%77b.~%-|%-|%-Tz%4-Tz%X->%X-@#-ؽ"-Կ"jJ.v"7K7K7K7K7K7K7K7K7K7K777777777KG777J7jJ.v"7]7_7dTU."@_7bTU." 66]6_6d/(#@_6b/R# ."#6&/#&/D#f/%#/%#."#7K7K7K7K7K7777K667d-.)27d-.)67d-.)-.)-=)W-=)-?)8K8K8K8K8K8888K6678&/#&/0"/!DC.!d-"d-.)8K8K8K8K8K8K 8 8 8 8 8KG667666J6-?)z4]6_6dz$.?)@_6bEK.?) @7+4,4{18.(4]8_8d..)@_8b.t?) ,4N05308888$8&8)&8+&8-&8/1 2LRR6F88L?.&(1l8n81p888N0548+8+8*8+8$18&18)&18+&18-&18/1 "278$88&88)&88+&88-&88/1USER SAW - DCC6C788988;?8=?811=?844=?833=?822=?866=?855L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2SAWBG8DG8AD-233C:\Users\Public\Documents\PCB Artist\Library\AD.sslULRU3F1808R<.J'H2 SAW - DCC6CJLK8{M8 &9' 5'9' 5'|& &|& && p&& p&f& &f&O8N8N8N8N8N8N8N8N8P8Q8R8S8T8U8V8TLK8{W8 ء&B' ?'B' ?'& ء&&Y8X8X8X8X8Z8[8\8VXK8&>&ZPS1_6_1!\]^8_^8d&9&@_^8b&Z% XK8&>&_8\]c8_c8d&9&@_c8b&Z% XK8'>&_8\]g8_g8d'9&@_g8b'Z% XK8'B'_8 \]k8_k8d'1f'@_k8b's' XK8&B'_8 \]o8_o8d&1f'@_o8b&s' XK8&'ZStyle2_1: \]s8_s8d&W'@_s8b&de'  ]K8_K8ء&['T&&L8c8cl08n08M8n08W8p0808{1~82k.'(^8]~8_~8d2k.^'@_~8b2k.`' /808{18r .'(g8]8_8dr .^'@_8br .`' 08{18r .'k8]8_8dr .(@_8br .,"( 08N05378888$8&8)&8+&8-&8/1 2LRR3F88"T.,'1l8n81p88N05368888$8&8)&8+&8-&8/1 2LRR4F88L.*'1l8n81p888{18.*'1]8_8b].' _8d.*'@]8_8/`p'T81]8_8b.' _8d.*'@.*'8om.,'.,'.*'8^58^58^588^5888$8&8)&8+&8-&8/11LRC12F88l.B'1l8n81p888N05348888$8&8)&8+&8-&8/14LRL8F88BD.\&1l8n81p88N05328888$8&8)&8+&8-&8/11LRC9F88^6.&1l8n81p88{18.&1]8_8b:.& _8d.&@8]8_8|)-&T81]8_8bom.& _8dO.&@O.&8BD.&BD._&O.&8^58^58^588^5888$9&9)&9+&9-&9/11LRC8F99l.Tx&1l9n91p999N0531999$9&9)&9+&9-&9/11LRC11F99.b&1l9n91p9989. '1]9_9bb.s'' _9d. '@9]9_9 /l&T 91]9_9bb.& _9d.&@.&9$,9&,9)&,9+&,9-&,9/14LRL7F,9+9.&1l+9n+91p+9*9+9N053389897989$>9&>9)&>9+&>9-&>9/11LRC10F>9=9P.p&1l=9n=91p=9=9{1H9P.'1]H9_H9b. ' _H9dP.'@<9]=9_=9/̻&T ;91]<9_<9b.& _<9dP.#&@P.#&:9չ.&չ.&P.#&R9^5R9^5R9^5T9U9^5G8979;9d569չ.&1]69_69b.& _69dչ.&@]+9_+9/&T)91]*9_*9b.& _*9d;.&@;.&9.&.Y&;.&_9^5_9^5_9^5a9b9^59)99c9;.&;.Ry&=.Tx&d9^5d9^5d9^5f9g9^5999$l9&l9)&l9+&l9-&l9/14LRL5Fl9k9Ɓ./&1lk9nk91pk9k9N0555x9x9x91{9h]|9_|9dr.q!&@_|9br./& r.%w9z9r.%r.&Ɓ.&9K9K9K99KGx9{9w9Jv9Ɓ.&1]v9_v9b.]4& _v9dƁ.&@j9]k9_k9h/&Ti91]j9_j9b.f& _j9dƁ.3I&@Ɓ.3I&h9=.Tx&=.M&Ɓ.3I&9^59^59^599^5G99)99i9d5 9=.Tx&1] 9_ 9b.& _ 9d=.Tx&@]9_9.Vw&T91]9_9bgq.& _9dS.Tx&@S.Tx&8O.&O.L|&S.Tx&9^59^59^599^5898$9&9)&9+&9-&9/14LRL6F99(Q.0&1l9n91p99N055499919l]9_9d4_.q!&@_9b4_./& 4_.%994_.%\_.c &(Q.&9K9K9K99KG999J9(Q.&1]9_9bn.[5& _9d(Q.&@9]9_9-Z&T91]9_9bn.g& _9d(Q.1J&@(Q.1J&9S.Tx&S.L&(Q.1J&9^59^59^599^5G88899d58BD.&1]8_8bb.& _8dBD.&@8]8_8}-\&T81]8_8bb.m*' _8dBD. '@BD. '8l.o)'a.o)'BD. '9^59^59^599^588 99l.o)'u.o)'. '9^59^59^599^5G888 9d58l.o)'1]8_8b.3G' _8dl.o)'@]8_8.1'T 81]8_8b.y' _8dl. \'@l. \'8om.,'om.\'l. \'9^59^59^599^5G8888d58om.,'1]8_8b3.' _8dom.,'@8]8_8Z:-ve'T_81]8_8bX.' _8d:.,'@:.,'8R<.'R<.':.,'9^59^59^599^5G888d58R<.'o8]8_8dR<.(@_8bR<.,"( 08{192k. 's8]9_9d2k."(@_9b2k.n0( ]08_08LA-r'T .8c8]/8_/8dR<.^'@_/8bR<.`' R<.'(-8L?.q(L?.*(R<.'(:^5:^5:^5::^5G+8*8.8d5)8L?.q(1])8_)8b].( _)8dL?.q(@]8_8Z.R(T 81]8_8b].7( _8dL?.s(@L?.s(83.(3.'(L?.s(:^5:^5:^5::^5888$:&:)&:+&:-&:/1 2LRR5F::.(1l:n:1p:::{1 : .(1] :_ :bѻ.( _ :d .(@]:_:.,(T:1]:_:b7.( _:dsk.(@sk.(:L?.s(g.s(sk.(*:^5*:^5*:^5,:-:^5888,4/:4]0:_0:dhL..)@_0:bhL.t?) hL.(.:3.(hL.(4:^54:^56:^58/:87:hL.(L.#(L?.s(8:^58:^58:^5::;:^5G888:/:d583.(4]8_8d3..)@_8b3.t?) 0:,4{1@:e.(4]@:_@:de..)@_@:be.t?) ,41E:. )4]E:_E:d. )@_E:b- ) ,4N0529L:L:K:L:$R:&R:)&R:+&R:-&R:/1 2LRR1FR:Q:.A<)1lQ:nQ:1pQ:P:Q:{1\:'/A<)1]\:_\:b-/Z) _\:d'/A<)@]Q:_Q:c/()TO:1]P:_P:bQ.Z) _P:d.A<)@.A<)N:.P&)."&)J.:).:).A<)f:Kf:Kf:Kf:Kf:Kh:i:j:k:KGL:K:O:JJ:.P&)4]J:_J:d.P&)@_J:b-P&) ,41p:.?)4]p:_p:d.?)@_p:b-?) ,41u:.Y)4]u:_u:d.Y)@_u:b-Y) ,4{1z:S.)4]z:_z:dS."( @_z:bS.(  ,4{1:a+.)4]:_:da+."( @_:ba+.(  ,4{1:S.CG)4]:_:dS.T( @_:bS.F(  ,4{1:+.CG)4]:_:d+.T( @_:b+.F(  ],4_,4-ر(T *44]+4_+4dz$. )@_+4bEK. ) - )'4f-8)-8)- ):K:K:K::K%4%4:^4/ $2:^4/ $(4:^4/ $^4/$.rk%/rk%/$%/ֺ$J/ $^4/ $:K:K:K:K:K:K:K::::::KG%4:(4*4$4J#4.(k%D]#4_#4d/(k%@_#4bfP/(k% '761N0538:::$:&:)&:+&:-&:/1 "2:$:&:)&:+&:-&:/1USER 4 pin OSC7:9:;:=:11=:22=:33=:44 >M5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2OSCB:D:XTAL9C:\Users\Public\Documents\PCB Artist\Library\Discrete.sslLROSCLROSC1F::2$&H2 4 pin OSCJL:{: &%+' SM'%+' SM'ߠ& &ߠ& &\& &\& && &&::::::::::::::::TL:{: 9&4' W'4' W'& 9&&::::::::VX:&&ZPS1_8z.>8_\]:_:d&s9&_@_:b&L&_ X:p''&:_\]:_:dp''s9&_@_:bp''L&_ X:p''$ ':\]:_:dp''R'_@_:bp''Vf'_ X:&$ ':\]:_:d&R'_@_:b&Vf'_ ]:_:9&M'T&&<M8c8cl:n::n::p::{1:2\%:]:_:d2U%_@_:b2%_ :N0556:::1;T];_;d/H%@_;bfP/H% .H%:;.H%l1%N2H~&H2H~&2C&;K;K;K;K;K ; ; ; ;K:::$;&;)&;+&;-&;/11LRC14F;;s37&1l;n;1p;;{1;37&1];_;bߪ3U& _;d37&@;];_;3 &T_;1];_;bEx3U& _;dZ37&@Z37& ;2C&kN3C&Z37&%;K%;K%;K';(;KG:;:;J:2C&:]:_:d2%_@_:b2X%_ :{1-;`w2C&:]-;_-;b`w2&_ _-;d`w2ۋ&_@:]:_:z2.%>..%.%7;K7;K7;K7;K7;K7;K7;K9;:;;;<;=;>;K:::$C;&C;)&C;+&C;-&C;/11LRC13FC;B;s3d%1lB;nB;1pB;B;{1M;3d%1]M;_M;bߪ3(& _M;d3d%@A;]B;_B;3%T_@;1]A;_A;bEx3(& _A;dZ3d%@Z3d%?;`w2\%`w2W &Z3W &Z3d%W;KW;KW;KW;KY;Z;[;KG:::@;J:.%P]:_:d/%@_:bfP/% ;11`;.%X]`;_`;d.q!&@_`;b./& 1N0539g;g;g;$m;&m;)&m;+&m;-&m;/1:LROSC2Fm;l;*2H&:ll;nl;:nl;:pl;l;{1x;L2&:]x;_x;dL2B&_@_x;bL2 &_ l;N0557;;;1;`];_;d̙.q!&@_;b̙./& ̙.%~;;̙.%.n%. &. &/C&_1C&2Vu'2Vu'L20';K;K;K;K;K;K;K;K;K;;;;;;;;K;~;;$;&;)&;+&;-&;/11LRC16F;;3"'1l;n;1p;;{1;3"'1];_;b3-' _;d3"'@;];_;3b&T_;1];_;b3-' _;dMt3"'@Mt3"';L20'_T30'Mt3"';K;K;K;;KG;;~;;J};L20':]};_};dL2&_@_};bL2|q&_ l;{1;20':];_;b2B'_ _;d2w'_@k;]l;_l; Y1&T_j;:]k;_k;b2&'_ _k;d2o'_@2&g;$;&;)&;+&;-&;/11LRC15F;;3&1l;n;1p;;{1;3&1];_;b3~& _;d3&@;];_;3&T_;1];_;b3~& _;dOs3&@Os3&i;2&2&2&2@&l3@&Os3&Os3&;K;K;K;K;K;K;K;;;;;;Kg;f;j;;T.%l.%l.j%Z.X%.X%/&&f1&&N2&82&2&;K;K;K;K;K;K;K;K;K;K;;;;;;;;;KGg;j;;f;Je;T.%\]e;_e;dT.q!&@_e;bT./& ;11;D.%d];_;dD.q!&@_;bD./& |9911;K.%p];_;dK.q!&@_;bK./& 11;$8.%t];_;d$8.q!&@_;b$8./& 1N0535;;;;$<&<)&<+&<-&</1 2LRR2F<<-.&1l/V%2>/V%>/%/%/V%>K>K>K>>K1=1>0M.$2>0M.$>(.$4K.$0M.$ >K >K >K > >K111>-%2>-%>-Һ%-/%-%>K>K>K>>K1<1> .&2> .&>v*.&3 .& .&>K>K>K>>K1=1>DA/^m)2>DA/^m)>/Xp)J>/Xp)DA/^m)>K>K>K!>">K1<1$>/*)BB/*)K&>K&>K(>)>K11$.>&.>)&.>+&.>-&.>/11LRC19F.>->3Hx)1l->n->1p->->{18>3)1]8>_8>bt3Y) _8>d3)@,>]->_->g3)T +>1],>_,>bt3|) _,>d3^)@3^)1B>3+)2B>3+)*>3^)3,)3+)D>KD>KD>KF>G>K1v31I>4+)2I>4+)H> 4c) 4.)4+)K>KK>KK>KM>N>K1]71P>z/"2P>z/"O>.ھ"."z/"R>KR>KR>KT>U>K171W>V-ػ#2W>V-ػ#V>۸-D#۸-]#V-ػ#Y>KY>KY>K[>\>K1<1^>.+&2^>.+&]>j.s)&.s)&.+&`>K`>K`>Kb>c>K11$h>&h>)&h>+&h>-&h>/11LRC35Fh>g>,1$1lg>ng>1pg>g>{1r>,1[$1]r>_r>b1$ _r>d,1[$@f>]g>_g>~1\x$Te>1]f>_f>b1% _f>d,1$@,1$1$>&>)&>+&>-&>/1 "2>$>&>)&>+&>-&>/1SM735337>9>;>=>11=>22=>33=>44=>55=>66/kM5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@2TPS73533B>D>73533OUTNRGNDENN/CIN5C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRRegLRReg1F>~>2v$H273533JL>{> &6' B'6' B'L& &L& && \&& \&"' &"'>>>>>>>>>>>>>>>>TL>{> &p@' ('p@' ('& &&>>>>>>>>VX>&~&ZPS1_7<\]>_>d&g>&@_>b&U% X>|&~&>\]>_>d|&g>&@_>b|&U% X> '~&>\]>_>d 'g>&@_>b 'U% X> 'z'> \]>_>d 'ie'@_>b 'r' X>|&z'> \]>_>d|&ie'@_>b|&r' X>&z'> \]>_>d&ie'@_>b&r' X>|&|&Z PS1_1_3_2@6_\]>_>d|&CO'@_>b|&R' ]>_>&>Y'T|&|&oiM8c8cl~>n~>>n~>>p~>}>~>N0558>>>$>&>)&>+&>-&>/11LRC36F>>2$1l>n>1p>>{1>2c$1]>_>bn&2'$ _>d2c$@>]>_>1`v$T>1]>_>bn&2% _>d2$@2$>>2$g2$j2v$>K>K>K>>KG>>>J>j2v$>]>_>dj2__$@_>bj2M $ ~>{1>j2$>]>_>dj2E$@_>bj2$ ~>N0549>>>$?&?)&?+&?-&?/1 "2?$?&?)&?+&?-&?/1USERDC_MOLEX_A-5569-02A2G7?9?;?=?11=?22L5C:\Users\Public\Documents\PCB Artist\Library\LRRF.psl@24 pin Power ConnectorB?D?Power Connector125C:\Users\Public\Documents\PCB Artist\Library\LRRF.sslLRPowerLRPower1F??4:# p?? ]?_?dj4#@_?bj4X# >?{1?4.% ]?_?dj4%@_?bj4L% > ]>_>dj4@:$@_>bj4u$ 4X$>$'?&'?)&'?+&'?-&'?/11LRC29F'?&?v3$1l&?n&?1p&?&?{11?v3$1]1?_1?b3% _1?dv3$@%?]&?_&? U3"$T $?1]%?_%?b3$ _%?dv3K$@v3K$>4X$3X$v3K$;?K;?K;?K=?>?K>$?>??v3K$U2K$2$@?K@?K@?KB?C?K>>~>E?>]F?_F?d2K%@_F?b2vX% 2%$?D?2%933%v3K$J?KJ?KJ?KL?M?KG>>$?>E?J>2$>]>_>d2%@_>b2%% ~>{1R?2v$>]R?_R?d2e2%@_R?b2?% F?~>{1W?2v$>]W?_W?dW2v$@_W?b12v$ ]~>_~>p2.$T|>>]}>_}>dj2x$@_}>bj29$ j2%d>,1$,1`$"1V$ 1V$1"%fL2"%j2%a?Ka?Ka?Ka?Ka?Ka?Ka?Kc?d?e?f?g?h?K1e>1j?1I%2j?1I%i?,1$,1?%1I%l?Kl?Kl?Kn?o?KG1=>=>>>>$>B>I>j?P>W>^>11<;<;;v3]77e>|>1̍Ls? -, ,, , , u. , .@=@=@?@֍s? w/`z"  w/@" A@@@@@B@֍s? /0*mX /9*lX i/0* p/d)  p/d)D@C@C@C@C@C@E@F@G@H@֍s? /vi%  //% J@I@I@K@֍s? g/%18 /6 %  /6 % G/$08 ./z$  /z$M@L@L@L@L@L@L@N@O@P@Q@R@֍s? L/# /< $  &/< $( :/# /#  `/#)T@S@S@S@S@S@S@U@V@W@X@Y@֍s? /T  jU/T [@Z@Z@\@֍s? /W'  Z40W' ^@]@]@_@֍s? 0>(  "P0>( a@`@`@b@֍s? 0 ,  / , d@c@c@e@֍s? N:0X*  s0X* g@f@f@h@֍s? v0++@ *0 ,+@ v0: ,*@ 0 ,*@j@i@i@i@i@k@l@m@֍s? 0dh*  1dh* o@n@n@p@֍s? 1++@ 0 ,+@ 1: ,*@ gk1 ,*@r@q@q@q@q@s@t@u@֍s? 1$  1$ w@v@v@x@֍s? R1I%  1I% z@y@y@{@֍s? ,1++@ E|1 ,+@ ,1: ,*@ 2 ,*@}@|@|@|@|@~@@@֍s? 34:#  4:# @@@@֍s? J4X$  4X$ @@@@֍s? J4.%  4.% @@@@֍s? QS4*a \84*  4*` p4*` 4w*  \84w*a@@@@@@@@@@@@֍s? z4): X4)A 4)9 H4)@@@@@@@@@֍s? T4+)  4+) @@@@֍s? 4a5/+  4/+ @@@@56r?-,q?-,1̍L@ /d) p/d)@@@56@/d)@/d)1̍L@ /d) p/d)@@@56@/d)@/d)1̍L@ /z) /)@@@56@/z)@/z)1̍L@ 0M.$ 0M.v$@@@56@0M.$@0M.$1̍L@ FB.$ j0.$@@@56@FB.$@FB.$1̍L@ 0M.$ 0M.$@@@56@0M.$@0M.$1̍L@ /R% x'/R%@@@56@/R%@/R%1̍L@ /]% /jo%@@A56@ /]%@ /]%1̍LA .R% .R%AAA56A.R%A.R%1̍L A /G% /5% A AA56 A /G% A /G%1̍LA ~$/V% Z6/V%AAA56A~$/V%A~$/V%1̍LA /@& /&AAA56A/@&A/@&1̍L!A /V% .V%"A"A$A56 A/V%A/V%1̍L(A /l% /%)A)A+A56'A/l%&A/l%1̍L/A .& |'.&0A0A2A56.A.&-A.&1̍L6A .#& .5&7A7A9A565A .#&4A .#&1̍L=A -& -&>A>A@A56% 1,%AAA56A1>%A1>%1̍LA /" /"AAA56A/"A/"1̍LA z/" z/"AAA56Az/"Az/"1̍LA o/" ^/"AAA56Ao/"Ao/"1̍LA z/" z/ "AAA56Az/"Az/"1̍LA @-ػ# -ػ#AAA56A@-ػ#A@-ػ#1̍LA V-# V-#AAA56AV-#AV-#1̍LB l-ػ# -ػ#BBB56Bl-ػ#Al-ػ#1̍LB V-# V-# B B B56BV-#BV-#1̍LB .+& .+&BBB56B.+& B.+&1̍LB 2.+& V.+&BBB56B2.+&B2.+&1̍LB .!& .(&BB B56B.!&B.!&1-Һ%1]1_1bo-% _1d-Һ%@]1_1,%T~11]1_1bջ-% _1d-Һ%@-Һ%5<}1-Һ%- %-"%*BK*BK*BK,B-BK{1<<.B.(/(/BK/BK1BK{1=#=2B.)/)3BK3BK5BK{19>36B3)3:H*|4*7BK7BK7BK9B:BK{1={1BK>BK>BK@BABK{1={1CBq/%2CBq/%BBH/%[/%[/%q/%EBKEBKEBKEBKGBHBIBK{1#={1KBH?/)2KBH?/)JB/)J>/)H?/)MBKMBKMBKOBPBK{1]:{1RB:F/9)2RB:F/9)QB'/A<)C/A<):F/9)TBKTBKTBKVBWBK{1<{1YB=mBn,/*a/*nBKnBKpBK{1>={1rB/*2rB/*qBa/*1/*/*tBKtBKtBKvBwBK{15{1yB -*2yB  -*xB%.Rq*-Rq* -*{BK{BK{BK}B~BK{1{5{1Bh.B*2B h.B*BYx.D*j.D*h.B*BKBKBKBBK{15{1B-N+2B -N+B-O+-O+-N+BKBKBKBBK{16{1B.)2B.)B3.-)3.).)BKBKBKBBK{18{1B.ر(2B.ر(B.(4.\(4.^(.ر(BKBKBKBKBBBK{14{1B.ʶ)2B.ʶ)Be.-)`f.x).ʶ)BKBKBKBBK{1!:{1B".(2B".(B .(,.(".(BKBKBKBBK{1;;B3"'3&3&BKBKBKBBK{1;{1B3th&2B3th&B3&3&3:&3th&BKBKBKBKBBBK{1N;;B3d%37&BKBKBK{1;BB37&3e&3th&BKBKBKBBK{18{1B-&2B-&B.&-&BKBKBK{1~1{1BV-p%2BV-p%B-Һ%-+%V-p%BKBKBKBBK{1I9{1B.( '2B.( 'BP.'P.8'.8'.( 'BKBKBKBKBBBK{1<8Bv*.+M&v*.&.&BKBKBKBBK{1<{1B.b&2B.b&Bj. \&. \&.b&BKBKBKBBK{1={1B-r$2B-r$B_-$_--$-r$BKBKBKBBK{18{1B .('2B .('Br .'r .' .('BKBKBKBBK{19{1Bv.'2Bv.'B2k. '. 'v.'BKBKBKBBK{18BB2k.'(2k.(v.'BKBKBKBBK{18BBr .'(r .(.ر(BKBKBKBBK{18{1C/.'2C/.'C.*'/*'/.'CKCKCKCCK{1A:BCe.(o.(".(CKCKCK C CK{12?? Cv3$I4$4.% CK CK CKCCK{12?{1Cu34%2Cu34%Cv3$v33%u34%CKCKCKCCK{1s>{1C1޶$2C1޶$C,1[$1[$1޶$CKCKCKCCK{1S?{1 C2z$2 C2z$C2v$2v$2z$"CK"CK"CK$C%CK{1>{1'Cc24$2'Cc24$&Cj2$Pi2$a2$a20$c24$)CK)CK)CK)CK)CK+C,C-C.CK{1>>/C2c$M2c$j2$0CK0CK0CK2C3CK{1s>>4C,1[$2[$2c$5CK5CK5CK7C8CK{1{1:Ci2'2:Ci2';9Ci2'2'20'C?CK{1y;{1ACt!3&2ACt!3&@CL2& 3&t!3&CCKCCKCCKECFCK{1.;{1HCDK>DK>DK@DADK{1d3==]:5=p=U=>=5{55684!:;;N;;8I9<<=89888A:2??s>S?>>;y;.;:Q5L5B5G5X7iCCC::{::K-Zk+ >-6+ -,,  rO.,, +.+ +.Zk+ d3.Zk+ d3.D+ e.D+ e. + . + .+-H ..B*-H .* .|* e.|* b.|* b.* b.ح* b.* e.* e.U* d.U* d.3* d.'* d.* ~k.* fl.* x.* x.** x.8* .8* .8* /8* /8* E?E@EAEBECE֍D ~-% ~-% ~-% V-6&6 H-\& H-(& H-4& H-vg& -vg& -4& -K2&R .'7& .9& .ll& b4.ll& b4..& j0..& -.& -&> -0&  -&= -κ& -& z(.& z(.h& z(.P& z(.+' XE.+' (Q.7' (Q.<' (Q.H' (Q.dn' .N.dn' .dn' .u'ߕ .bo'  .'ޕ .' .' m%.' m%.' !.' -' -' !.' '.' P.' P.:( .:( .گ' V.گ' V.' 7S.' 7S.' Z.' .' .' X.' @.' .' .-'͂ /'  /hl'͂ ./q' .bo' @.bo' X.bo' .bo' .dn' .dn' .H' .<' .4' .(' f.(' f.!' $.!'R .)'  .b&p .& .d& .|& .& .& ..& |..& ~..& ~.N{& .N{&v .F&l o.G&ۅ .;& //-R&ȯ /(X& W1(X& '2Ń'ȯ 2' 2'ȯ u2Ń' (2Z' m3Z' m3B' _T3B'ȯ a3e=' .s3+' 3+' 3+' (3+' (3Z& 3Z& 3Z& U3Z& U3' L36' m36' m3 ' )2 ' +2 ' ʁ2 'D i2P&O 2M2' t1b;& 1b;& ?2&ȯ N2& }2& }2& +2& )2& m3& m3& t!3v&  t!3& m3~& m3& T3& T3& 3& 3& *3& *3& 3& 3& )3& )3&ȯ 3& y3&ȯ l3f& 2f&n 2& ԭ2}& }2}& }2F& V2F& չ1&ȯ f1& (/& 7/V% 7/\% g/\% g/%N q/^% /D% ~1% ?2&ȯ N2& H2&ȯ 2& 2m& 2m& 2V& kN3V&d X3S& m3S& v3S& 3:& x3S& \3S& \3& y3& m3& d3& Vm3, & m3, & y3, & \3, & \3% y3% m3% @;3% @;3}% 2}% 2Y% 2Y% 2Y% 2Y% 2.%j >z2ď% x/ď% 02% "0#% "0$ȯ 05u$ /<$ /# /# /# /D#ȯ {/t7# /#ȯ f/.# L/.# L/`" .`" ." M/" M/8" g/8"Z /"J e/d" M/d" M/(" .(" .T" :M/T" :M/4" .4" .S" .S" ʟ.S" ʟ.4" B-4" B-" ." .ė" -ė" -j" -j"I -i" I-a2#ȯ C-@# C->%ȯ I-% [-Zw% }-Zw% }-%EEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEDEFEGEHEIEJEKELEMENEOEPEQERESETEUEVEWEXEYEZE[E\E]E^E_E`EaEbEcEdEeEfEgEhEiEjEkElEmEnEoEpEqErEsEtEuEvEwExEyEzE{E|E}E~EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEFFFFFFFFF F F F F FFFFFFFFFFFFFFFFFFF F!F"F#F$F%F&F'F(F)F*F+F,F-F.F/F0F1F2F3F4F5F6F7F8F9F:F֍D -)  ^-) F>F@F֍D =.+  .+ BFAFAFCF֍D T_.T  `-T EFDFDFFF֍D v.V'  v.ʺ' HFGFGFIF֍D .  . KFJFJFLF֍D n,/@z*  n,/̳* NFMFMFOF֍D w/`z"  w/@" QFPFPFRF֍D /T  S/T TFSFSFUF֍D *0k' *0(ȯ % 0 ( 1g* 1+ 1+ 1G+ 1S+ 1$+ 1$+ 1+! E|1 ,+@ ,1: ,*@ 2 ,*@ ,1++v L1+ L1$+ :1$+ :1S+ :1G+ :1+ ں1+ ں1v_*ȯ ߴ1Q* +0%( +03( B<2w* B<2+ X12+ X12B+ X12N+ X12.+ 82.+ 82+5 $2 ,  Kw2 , a2+ a2.+ h2.+ h2N+ h2B+ h2+ a2+ a2*ȯ q\2T* B@0%( B@0(E Q0>(w +0' +0k' Z40W'  /W'WFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFVFXFYFZF[F\F]F^F_F`FaFbFcFdFeFfFgFhFiFjFkFlFmFnFoFpFqFrFsFtFuFvFwFxFyFzF{F|F}F~FFFFFFFFFFFFF֍D 0 ,  / , FFFF֍D T70O+ T70z[+ T70+ >0+ >0+5 *0 ,+@ v0: ,*@ 0 ,*@ v0+r g0+ g0+ n0+ n0z[+ n0O+ n0+ i0+ i0+ s0X*  N:0X* :D0+ :D0+ T70+FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF֍D 0H+ 0T+ 0"+ 0"+ 0+! 0 ,+@ 1: ,*@ gk1 ,*@ 1++v 1+ 1"+ 1"+ 1T+ 1H+ 1+ 1+ 1!~* 1dh*  0dh* 0!~* 0+ 0+FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF֍D 1$  1$ FFFF֍D d1$ d1$ d16 % R16 % R1?%5 ٵ19D%* R1I%  1I% 1\.% 1% h1[/%ȯ 14% fL24%ȯ Y2[/% o2\% "2\% 2%% 2\% 2\% 2% 933%ȯ @3/% [3$ [3&% 3&% 3$ 3$ 3,$ 3j$ C4j$̀ :4X$̀ C4*E$ 3*E$ȯ 3J$ `{3 $ [3 $ [3q$ U2q$ȯ 2$ g2$ 2$ 2$ "2$ @M2$ @M2#$ r$2#$ r$2$ r$2$ r$2"$ 1"$ 1$ 1$ 1$ a1$ 1$ 1$ 1$ 1$ d1$FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF֍D c2$  c2no$ FFFF֍D 22%  22tj% FFFG֍D f3Tr) f3<~) f3ְ) x3ְ) x3<~) x3Tr) x3?) 3?) 3+)  Xe3+) l3?) f3?)GGGGGGGGGGGGGGGGGGG G G G G G֍D u3Q%  u3% GGGG֍D h3/+  2/+ GGGG֍D 3* L3*  +4* 4* +4w*  L3w*GGGGGGGGGGGG֍D )4:#  4:# GGGG֍D A4.%  :4.% GGG G֍D O4* 64*  T4*J 4* u4_m*ȯ 4 `* 4̵) 4̵) 42) 4Jw) 4D) 4D)C p4+)  Ĭ4+)ϫ F4@) F4D) X4D) X4Jw) X42) X4) z4): X4) a4s) a4L*y^ 64w*"G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G!G#G$G%G&G'G(G)G*G+G,G-G.G/G0G1G2G3G4G5G6G7G8G9G:G֍D n5/+  84/+ {* %.*GGG6G%.>{*G%.>{*{1̍LG .Rq* -Rq*GGG6G.Rq*G.Rq*{1̍LG Yx.0+ Yx. +GGG6GYx.0+GYx.0+{1̍LG Yx.X* Yx.|*GGG6GYx.X*GYx.X*{1̍LG -~Y+ -Zk+GGG6G-~Y+G-~Y+{1̍LG $-O+ H-O+GGG6G$-O+G$-O+{1̍LG -E+ -3+GGG6G-E+G-E+{1̍LG Π.dd, .dd,GGG6GΠ.dd,GΠ.dd,{1̍LG N.dd, =.dd,GGG6GN.dd,GN.dd,{1̍LG w.p;, w.),GGG6Gw.p;,Gw.p;,{1̍LG Π.+ .+GGG6GΠ.+GΠ.+{1̍LG w.+ w.+GGG6Gw.+Gw.+{1̍LH N.+ =.+HHH6HN.+GN.+{1̍LH w.u+ w.$c+ H H H6Hw.u+Hw.u+{1̍LH ^-+ :-+HHH6H^-+ H^-+{1̍LH j-+ j-+HHH6Hj-+Hj-+{1̍LH v-+ v-+HH H6Hv-+Hv-+{1̍L$H ^-dd, :-dd,%H%H'H6#H^-dd,"H^-dd,{1̍L+H v-dd, v-dd,,H,H.H6*Hv-dd,)Hv-dd,{1̍L2H j-p;, j-),3H3H5H61Hj-p;,0Hj-p;,{1̍L9H .& .&:H:HH. &{1̍LGH P."' P.!'HHHHJH6FHP."'EHP."'{1̍LNH -5H& -5H&OHOHQH6MH-5H&LH-5H&{1̍LUH -U& -vg&VHVHXH6TH-U&SH-U&{1̍L\H $-5H& H-5H&]H]H_H6[H$-5H&ZH$-5H&{1̍LcH s.'( .'(dHdHfH6bHs.'(aHs.'({1̍LjH 2k.4( 2k.F(kHkHmH6iH2k.4(hH2k.4({1̍LqH 2k.( 2k.(rHrHtH6pH2k.(oH2k.({1̍LxH r .4( r .F(yHyH{H6wHr .4(vHr .4({1̍LH .'( -'(HHH6~H.'(}H.'({1̍LH r .( r .(HHH6Hr .(Hr .({1̍LH r .' r .'HHH6Hr .'Hr .'{1̍LH .' -'HHH6H.'H.'{1̍LH r .¿' r .'HHH6Hr .¿'Hr .¿'{1̍LH s. ' . 'HHH6Hs. 'Hs. '{1̍LH 2k.^' 2k.:(HHH6H2k.^'H2k.^'{1̍LH 2k.' 2k.گ'HHH6H2k.'H2k.'{1̍LH .' .'HHH6H.'H.'{1̍LH .>' .bo'HHH6H.>'H.>'{1̍LH .ر( .(HHH6H .ر(H .ر({1̍LH .( .$(HHH6H .(H .({1̍LH 2\% 2\%HHH6H2\%H2\%{1̍LH 25% 2Y%HHH6H25%H25%{1̍LH d2C& ?R2C&HHH6Hd2C&Hd2C&{1̍LH L2& L2&HHH6HL2&HL2&{1̍LH 2' 2 'HHH6H2'H2'{1̍LH 3d% \3d%HHH6H3d%H3d%{1̍LH 3P% 3, &HHI6H3P%H3P%{1̍LI 3x% 3%III6I3x%I3x%{1̍L I 37& \37& I II6 I37& I37&{1̍LI 3-& 3&III6I3-&I3-&{1̍LI N3& *3&III6IN3&IN3&{1̍L I 3& 3&!I!I#I6I3&I3&{1̍L'I 3κ& 3&(I(I*I6&I3κ&%I3κ&{1̍L.I L3"' (3"'/I/I1I6-IL3"',IL3"'{1̍L5I 3' 3+'6I6I8I64I3'3I3'{1̍LJ0.(=J0.({1̍LFJ .) .)GJGJIJ6EJ.)DJ.){1̍LMJ .W) .3)NJNJPJ6LJ.W)KJ.W){1̍LTJ ,.) P.)UJUJWJ6SJ,.)RJ,.){1̍L[J /W) /3)\J\J^J6ZJ/W)YJ/W){1̍LbJ /) .)cJcJeJ6aJ/)`J/){1̍LiJ /( .(jJjJlJ6hJ/(gJ/({1̍LpJ /+( /O(qJqJsJ6oJ/+(nJ/+({1̍LwJ j.ri& j.N{&xJxJzJ6vJj.ri&uJj.ri&{1̍L~J v*.Z& v*.ll&JJJ6}Jv*.Z&|Jv*.Z&{1̍LJ .+M& .+M&JJJ6J .+M&J .+M&{1̍LJ _2$ @M2$JJJ6J_2$J_2${1̍LJ j2l$ j2$JJJ6Jj2l$Jj2l${1̍LJ 3$ 3$JJJ6J3$J3${1̍LJ v3J% v3&%JJJ6Jv3J%Jv3J%{1̍LJ a/&* a/8*JJJ6Ja/&*Ja/&*{1̍LJ .&* .8*JJJ6J.&*J.&*{1̍LJ _-$ _-$JJJ6J_-$J_-${1̍LJ @.&* @.8*JJJ6J@.&*J@.&*{1̍LJ T.* x.*JJJ6JT.*JT.*{1̍LJ ^4.% :4.%JJJ6J^4.%J^4.%{1̍LJ 4a% 4ps%JJJ6J4a%J4a%{1̍LJ R4.% A4.%JJJ6JR4.%JR4.%{1̍LJ 4$$ 4H$JJJ6J4$$J4$${1̍LJ H/% H/\%JJJ6JH/%JH/%{1̍LJ 1[$ 1[$JJJ6J1[$J1[${1̍LJ @1[$ d1[$JJJ6J@1[$J@1[${1̍LJ ,1$ ,1$JJJ6J,1$J,1${1̍LK 2c$ r$2c$KKK6K2c$K2c${1̍L K 1c$ 1c$ K K K6 K1c$K1c${1̍LK 2$ 2"$KKK6K2$K2${1̍LK /T /TKKK6K /TK /T{1̍LK /r /N K K"K6K/rK/r{1̍L&K d/T S/T'K'K)K6%Kd/T$Kd/T{1̍L-K /6 /Z.K.K0K6,K/6+K/6{1̍L4K xM.T T_.T5K5K7K63KxM.T2KxM.T{1̍L;K Z+.r Z+.NK6:KZ+.r9KZ+.r{1̍LBK < .T `-TCKCKEK6AK< .T@K< .T{1̍LIK Z+.6 Z+.ZJKJKLK6HKZ+.6GKZ+.6{1̍LPK L.' .b&LLL6K.>'K.>'{1̍LL 3th& f3th&LL L6L3th&L3th&{1̍L L 3^s& 3:&LLL6 L3^s& L3^s&{1̍LL 3th& m3th&LLL6L3th&L3th&{1̍LL …-) -)LLL6L…-)L…-){1̍L"L z-) z-x)#L#L%L6!Lz-) Lz-){1̍L)L o-) ^-)*L*L,L6(Lo-)'Lo-){1̍L0L z-ȷ) z-)1L1L3L6/Lz-ȷ).Lz-ȷ){1̍L7L |/% /%8L8L:L66L|/%5L|/%{1̍L>L q/% q/^%?L?LAL6=Lq/%' .bo'MMM6M .>'M .>'{1̍LM `.' <.'MMM6M`.'M`.'{1̍LM v.z' v.V'MM!M6Mv.z'Mv.z'{1̍L%M .' .'&M&M(M6$M.'#M.'{1̍L,M v.' v.ʺ'-M-M/M6+Mv.'*Mv.'{1̍L3M 1޶$ f1޶$4M4M6M62M1޶$1M1޶${1̍L:M 1$ 1$;M;M=M69M1$8M1${1̍LAM 1޶$ q1޶$BMBMDM6@M1޶$?M1޶${1̍LHM 1$ 1$IMIMKM6GM1$FM1${1̍LOM n24$ 24$PMPMRM6NMn24$MMn24${1̍LVM c2$ c2$WMWMYM6UMc2$TMc2${1̍L]M Y24$ ,G24$^M^M`M6\MY24$[MY24${1̍LdM c2J$ c2no$eMeMgM6cMc2J$bMc2J${1̍LkM 2:% 2:%lMlMnM6jM2:%iM2:%{1̍LrM 22$% 22%sMsMuM6qM22$%pM22$%{1̍LyM H2:% l2:%zMzM|M6xMH2:%wMH2:%{1̍LM 22P|% 22tj%MMM6M22P|%~M22P|%{1̍LM 3&MMM6M^,3&M^,3&{1̍LM t!3& t!3v&MMM6Mt!3&Mt!3&{1̍LM t!3ƾ& t!3&MMM6Mt!3ƾ&Mt!3ƾ&{1̍LM .b2^' U2'MMM6M.b2^'M.b2^'{1̍LM q2^' ?~2'MMM6Mq2^'Mq2^'{1̍LM . .MMM6M.M.{1̍LM . .MMM6M .M .{1̍LM . D.MMM6M .M .{1̍LM . .MMM6M .M .{1̍LM 2% 2O%MMM6M2%M2%{1̍LM 2% k2O%MMM6M 2%M 2%{1̍LM 2>$ k2$MMM6M 2>$M 2>${1̍LM 2>$ 2$MMM6M2>$M2>${1̍LM Ǖ-, ,, ,& }.&l .N=N=N?N֍M .(  .( AN@N@NBN֍M .)  .V( DNCNCNEN֍M .Vq)  .C) GNFNFNHN֍M .|)  .) JNININKN֍M t+.<%  t+.,% MNLNLNNN֍M t+.L~%  t+.P% PNONONQN֍M t+.%  t+.% SNRNRNTN֍M J@.I)  J@.) VNUNUNWN֍M @.+  .+ YNXNXNZN֍M 3X.$w j0.$L+ c.W$ X.$ f.$i 4.$e\N[N[N[N[N[N[N]N^N_N`NaN֍M \.T  -T cNbNbNdN֍M f.)  f.V( fNeNeNgN֍M f.Rs)  f.E) iNhNhNjN֍M j.2'  j.& lNkNkNmN֍M r.<%  r.,% oNnNnNpN֍M r.J%  r.Q% rNqNqNsN֍M r.%  r.% uNtNtNvN֍M .)  .) xNwNwNyN֍M v.V'  v.ʺ' {NzNzN|N֍M T.<%  T.,% ~N}N}NN֍M T.L~%  T.P% NNNN֍M T.%  T.% NNNN֍M ..B*  .B* NNNN֍M .G&#o .F&g -.F& .+&  V.+&NNNNNNNNNN֍M ".(  ".0( NNNN֍M .  . NNNN֍M .$  /$ NNNN֍M .)'  .b& NNNN֍M .R%  x'/R% NNNN֍M .V%  Z6/V% NNNN֍M /'  /hl' NNNN֍M n,/@z*  n,/̳* NNNN֍M 4/9)Pj H?/)mY K/)  ^/^m) 1P/T) V/") b/$ )_ (  "P0>( NNNN֍M 0 ,  / , NNNN֍M N:0X*  s0X* NNNN֍M v0++@ *0 ,+@ v0: ,*@ 0 ,*@NNNNNNNN֍M 0dh*  1dh* NNNN֍M 1++@ 0 ,+@ 1: ,*@ gk1 ,*@NNNNNNNN֍M 1$  1$ NNNN֍M R1I%  1I% NNNN֍M ,1++@ E|1 ,+@ ,1: ,*@ 2 ,*@OOOOOOOO֍M 34:#  4:# 4O3O3O5O֍M J4X$  4X$ 7O6O6O8O֍M J4.%  4.% :O9O9O;O֍M QS4*a \84*  4*` p4*` 4w*  \84w*a=OO?O@OAOBO֍M z4): X4)A 4)9 H4)@DOCOCOCOCOEOFOGO֍M T4+)  4+) IOHOHOJO֍M 4a5/+  4/+ LOKOKOMO6MǕ-,MǕ-,{1̍LQO .dd, .dd,ROROTO6PO.dd,OO.dd,{1̍LXO R.dd, @.dd,YOYO[O6WOR.dd,VOR.dd,{1̍L_O w.0?, w.T-,`O`ObO6^Ow.0?,]Ow.0?,{1̍LfO .+ .+gOgOiO6eO.+dO.+{1̍LmO w.(+ w.+nOnOpO6lOw.(+kOw.(+{1̍LtO R.+ @.+uOuOwO6sOR.+rOR.+{1̍L{O w.x+ w.f+|O|O~O6zOw.x+yOw.x+{1̍LO -+ z-+OOO6O-+O-+{1̍LO j-(+ j-+OOO6Oj-(+Oj-(+{1̍LO 6-+ Zz-+OOO6O6-+O6-+{1̍LO -dd, z-dd,OOO6O-dd,O-dd,{1̍LO 6-dd, Zz-dd,OOO6O6-dd,O6-dd,{1̍LO j-0?, j-T-,OOO6Oj-0?,Oj-0?,{1̍LO 72 , 2 ,OOO6O72 ,O72 ,{1̍LO 1k!, 1G3,OOO6O1k!,O1k!,{1̍LO 1+ 1+OOO6O1+O1+{1̍LO Y1 , gk1 ,OOO6OY1 ,OY1 ,{1̍LO :B1k!, :B1G3,OOO6O:B1k!,O:B1k!,{1̍LO :B1+ :B1+OOO6O:B1+O:B1+{1̍LO ߰0 , 0 ,OOO6O߰0 ,O߰0 ,{1̍LO 0k!, 0G3,OOO6O0k!,O0k!,{1̍LO 0+ 0+OOO6O0+O0+{1̍LO 30 , 0 ,OOO6O30 ,O30 ,{1̍LO /k!, /G3,OOO6O/k!,O/k!,{1̍LO / , / ,OOO6O/ ,O/ ,{1̍LP /+ /+PPP6O/+O/+{1̍LP XO5/+ 4a5/+PP P6PXO5/+PXO5/+{1̍LP x5b+ x5t+PPP6 Px5b+ Px5b+{1̍LP 4/+ 4/+PPP6P4/+P4/+{1̍LP x5* x5&*PPP6Px5*Px5*{1̍L#P y3/+ 3/+$P$P&P6"Py3/+!Py3/+{1̍L*P (F3b+ (F3t++P+P-P6)P(F3b+(P(F3b+{1̍L1P H3/+ l3/+2P2P4P60PH3/+/PH3/+{1̍L8P (F3* (F3&*9P9P;P67P(F3*6P(F3*{1̍L?P h4* D*4*@P@PBP6>Ph4*=Ph4*{1̍LFP |4* |4*GPGPIP6EP|4*DP|4*{1̍LMP 3* 3*NPNPPP6LP3*KP3*{1̍LTP ®4.% 4.%UPUPWP6SP®4.%RP®4.%{1̍L[P 4W% 4i%\P\P^P6ZP4W%YP4W%{1̍LbP \4.% J4.%cPcPeP6aP\4.%`P\4.%{1̍LiP 4% 4$jPjPlP6hP4%gP4%{1̍LpP /T /TqPqPsP6oP/TnP/T{1̍LwP / /xPxPzP6vP/uP/{1̍L~P Fg/T jU/TPPP6}PFg/T|PFg/T{1̍LP / /PPP6P/P/{1̍LP K.T \.TPPP6PK.TPK.T{1̍LP Z+. Z+.PPP6PZ+.PZ+.{1̍LP .T -TPPP6P .TP .T{1̍LP Z+. Z+.PPP6PZ+.PZ+.{1̍LP .Q6:Q -2*9Q -2*{1̍LBQ r-N+ N-N+CQCQEQ6AQr-N+@Qr-N+{1̍LIQ -N+ …-N+JQJQLQ6HQ-N+GQ-N+{1̍LPQ -C+ -1+QQQQSQ6OQ-C+NQ-C+{1̍LWQ .( ' /( 'XQXQZQ6VQ.( 'UQ.( '{1̍L^Q .' .)'_Q_QaQ6]Q.'\Q.'{1̍LeQ .( ' 6.( 'fQfQhQ6dQ.( 'cQ.( '{1̍LlQ .>' .b&mQmQoQ6kQ.>'jQ.>'{1̍LsQ 3th& f3th&tQtQvQ6rQ3th&qQ3th&{1̍LzQ 3^s& 3:&{Q{Q}Q6yQ3^s&xQ3^s&{1̍LQ 3th& m3th&QQQ6Q3th&Q3th&{1̍LQ 3]& 3K&QQQ6Q3]&Q3]&{1̍LQ …-) -)QQQ6Q…-)Q…-){1̍LQ z-) z-x)QQQ6Qz-)Qz-){1̍LQ o-) ^-)QQQ6Qo-)Qo-){1̍LQ z-ȷ) z-)QQQ6Qz-ȷ)Qz-ȷ){1̍LQ /L% p/L%QQQ6Q/L%Q/L%{1̍LQ /W% /vi%QQQ6Q/W%Q/W%{1̍LQ /L% p/L%QQQ6Q/L%Q/L%{1̍LQ /A% //%QQQ6Q/A%Q/A%{1̍LQ |/% /%QQQ6Q|/%Q|/%{1̍LQ q/% q/^%QQQ6Qq/%Qq/%{1̍LQ f/% U/%QQQ6Qf/%Qf/%{1̍LQ q/% q/Һ%QQQ6Qq/%Qq/%{1̍LQ &P/( b/(QQQ6Q&P/(Q&P/({1̍LQ R .) .|)?R?RAR6=R.)' .bo'BSBSDS6@S .>'?S .>'{1̍LHS `.' <.'ISISKS6GS`.'FS`.'{1̍LOS v.z' v.V'PSPSRS6NSv.z'MSv.z'{1̍LVS .' .'WSWSYS6US.'TS.'{1̍L]S v.' v.ʺ'^S^S`S6\Sv.'[Sv.'{1̍LdS 1޶$ f1޶$eSeSgS6cS1޶$bS1޶${1̍LkS 1$ 1$lSlSnS6jS1$iS1${1̍LrS 1޶$ q1޶$sSsSuS6qS1޶$pS1޶${1̍LyS 1$ 1$zSzS|S6xS1$wS1${1̍LS 3z$ 3z$SSS6S3z$~S3z${1̍LS 2d$ 2@%SSS6S2d$S2d${1̍LS 2z$ 2z$SSS6S2z$S2z${1̍LS 2$ 2$SSS6S2$S2${1̍LS n24$ 24$SSS6Sn24$Sn24${1̍LS c2$ c2$SSS6Sc2$Sc2${1̍LS Y24$ ,G24$SSS6SY24$SY24${1̍LS c2J$ c2no$SSS6Sc2J$Sc2J${1̍LS 2:% 2:%SSS6S2:%S2:%{1̍LS 22$% 22%SSS6S22$%S22$%{1̍LS H2:% l2:%SSS6SH2:%SH2:%{1̍LS 22P|% 22tj%SSS6S22P|%S22P|%{1̍LS &J2$& \2$&SSS6S&J2$&S&J2$&{1̍LS 3&SSS6S^,3&S^,3&{1̍LS t!3& t!3v&SSS6St!3&St!3&{1̍LS 3& 3&SST6S3&S3&{1̍LT t!3ƾ& t!3&TTT6Tt!3ƾ&Tt!3ƾ&{1̍L T t2' 2' T TT6 Tt2' Tt2'{1̍LT i2!' i22'TTT6Ti2!'Ti2!'{1̍LT ^2' M2'TTT6T^2'T^2'{1̍L!T i2, ' i2P&"T"T$T6 Ti2, 'Ti2, '{1̍L(T u.l& .l&)T)T+T6'Tu.l&&Tu.l&{1̍L/T j.V& j.2'0T0T2T6.Tj.V&-Tj.V&{1̍L6T `.l& .N.l&7T7T9T65T `.l&4T `.l&{1̍L=T j.& j.&>T>T@T6UJ.%{1̍LGU T.% T.%HUHUJU6FUT.%EUT.%{1̍LNU ^.% .%OUOUQU6MU^.%LU^.%{1̍LUU T.% T.%VUVUXU6TUT.%SUT.%{1̍L\U j0.%% FB.%%]U]U_U6[Uj0.%%ZUj0.%%{1̍LcU t+.*% t+.<%dUdUfU6bUt+.*%aUt+.*%{1̍LjU ~&.%% .%%kUkUmU6iU~&.%%hU~&.%%{1̍LqU t+.!% t+.,%rUrUtU6pUt+.!%oUt+.!%{1̍LxU w.%% .%%yUyU{U6wUw.%%vUw.%%{1̍LU r.*% r.<%UUU6~Ur.*%}Ur.*%{1̍LU m.%% \.%%UUU6Um.%%Um.%%{1̍LU r.!% r.,%UUU6Ur.!%Ur.!%{1̍LU J.%% &.%%UUU6UJ.%%UJ.%%{1̍LU T.*% T.<%UUU6UT.*%UT.*%{1̍LU ^.%% .%%UUU6U^.%%U^.%%{1̍LU T.!% T.,%UUU6UT.!%UT.!%{1̍LU J.zg% &.zg%UUU6UJ.zg%UJ.zg%{1̍LU T.pl% T.L~%UUU6UT.pl%UT.pl%{1̍LU ^.zg% .zg%UUU6U^.zg%U^.zg%{1̍LU T.b% T.P%UUU6UT.b%UT.b%{1̍LU j0.zg% FB.zg%UUU6Uj0.zg%Uj0.zg%{1̍LU t+.pl% t+.L~%UUU6Ut+.pl%Ut+.pl%{1̍LU ~&.zg% .zg%UUU6U~&.zg%U~&.zg%{1̍LU t+.b% t+.P%UUU6Ut+.b%Ut+.b%{1̍LU 2,% `2,%UUU6U2,%U2,%{1̍LU 2"% 2%%UUU6U2"%U2"%{1̍LU 2,% ~2,%UUU6U2,%U2,%{1̍LU 26 % 2Z$UUV6U26 %U26 %{1̍LV 2$ `2$VVV6V2$V2${1̍L V 2$ 2$ V VV6 V2$ V2${1̍LV 2$ ~2$VVV6V2$V2${1̍LV 2$ 2$VVV6V2$V2${1̍L V -6) .6)!V!V#V6V-6)V-6){1̍L'V - ) -)(V(V*V6&V- )%V- ){1̍L.V -6) 8-6)/V/V1V6-V-6),V-6){1̍L5V -Lv) -pd)6V6V8V64V-Lv)3V-Lv){1̍LV=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V=V?V@VAVBVCVDVEVFVGVHVIVJVKVLVMVNVOVPVQVRVSVTVUVVV֍5 , :5, .,k .dd,  =.dd,l _., -,k :-dd,  v-dd,lbVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaVaVcVdVeVfVgVhViVjVkVlVmVnVoVpVqVrV֍`V ,Q-) @G-.)  ̀-.)YH N-%)I% }-)O! ,-8)_ f-r( f-&> V-6& -%  .%RT q-M%| V-%> f-% f-Q% 1.$ _.$" a.$ m.$ȯ z.\$ y.\$ d.G:% .R%A #/a% 4/%k q/Һ%  q/^%D c/F% /& /'ȯ /' < 0 (ȯ 0( 0(; "P0>(  s0x' 0' 0Vo' 50W'> ,0B' ,0&ȯ '0& }/(i% /vi% /[% Y0& Y0*o N:0X*w l0,+T ~0X* ~0& 05w& 0R* 0dh*  1dh* 1R* 1t& X4) 4)9 H4)so x4;) c/&$ȯ /$ %/$< /z$" /$ p/$ p/$b O/K$"e R/ $C /,$ [.,$K0 .$ K/$ /$; &/< $( :/# /# /# /0"ȯ {/" /t!ȯ /! DC.!ȯ 5.t! V-"ȯ ,Q-"tVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVsVuVvVwVxVyVzV{V|V}V~VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV֍`V -(i+v v-+  :-+mL p-[c+ N-N+  …-N+VVVVVVVVVVVV֍`V -)  ^-) VVVV֍`V -,,  rO.,, VVVV֍`V -)  -pd) VVVV֍`V -&  -0& VVVV֍`V -&  |'.& VVVV֍`V -*  Z-* VVVV֍`V .'  .bo' VVVV֍`V .(  .( VVVV֍`V .)  .V( VVVV֍`V .Vq)  .C) VVVV֍`V .|)  .) VVVV֍`V t+.<%  t+.,% VVVV֍`V t+.L~%  t+.P% VVVV֍`V t+.%  t+.% VVVV֍`V =.+  .+ VVVV֍`V J@.I)  J@.) WVVW֍`V T_.T  `-T WWWW֍`V f.)  f.V( WWWW֍`V f.Rs)  f.E)  WWW W֍`V j.2'  j.&  W W W W֍`V r.<%  r.,% WWWW֍`V r.J%  r.Q% WWWW֍`V r.%  r.% WWWW֍`V .)  .) WWWW֍`V v.V'  v.ʺ' WWWW֍`V T.<%  T.,% WWWW֍`V T.L~%  T.P% !W W W"W֍`V T.%  T.% $W#W#W%W֍`V ..B*  .B* 'W&W&W(W֍`V .G&#o .F&g -.F& .+&  V.+&*W)W)W)W)W)W+W,W-W.W֍`V ".(  ".0( 0W/W/W1W֍`V .  . 3W2W2W4W֍`V .)'  .b& 6W5W5W7W֍`V .V%  Z6/V% 9W8W8W:W֍`V /'  /hl' W>W@W֍`V 4/9)Pj H?/)mY K/)  ^/^m) 1P/T) V/") b/$ )_ Y>Y@Y6' .b&YYY6Y.>'Y.>'{1̍LY 3th& f3th&YYY6Y3th&Y3th&{1̍LY 3^s& 3:&YYY6Y3^s&Y3^s&{1̍LY 3th& m3th&YYY6Y3th&Y3th&{1̍LY 3]& 3K&YYY6Y3]&Y3]&{1̍LY …-) -)YYY6Y…-)Y…-){1̍LZ z-) z-x)ZZZ6Zz-)Yz-){1̍LZ o-) ^-) Z Z Z6Zo-)Zo-){1̍LZ z-ȷ) z-)ZZZ6Zz-ȷ) Zz-ȷ){1̍LZ /W% /vi%ZZZ6Z/W%Z/W%{1̍LZ /L% p/L%ZZ Z6Z/L%Z/L%{1̍L$Z |/% /%%Z%Z'Z6#Z|/%"Z|/%{1̍L+Z q/% q/^%,Z,Z.Z6*Zq/%)Zq/%{1̍L2Z f/% U/%3Z3Z5Z61Zf/%0Zf/%{1̍L9Z q/% q/Һ%:Z:ZZ&P/({1̍LGZ ' .bo'[[[6[ .>'[ .>'{1̍L[ `.' <.'[[[6[`.'[`.'{1̍L[ v.z' v.V'[[[6[v.z'[v.z'{1̍L[ .' .'[[[6[.'[.'{1̍L[ v.' v.ʺ'[[[6[v.'[v.'{1̍L[ 1޶$ f1޶$[[[6[1޶$[1޶${1̍L[ 1$ 1$[[[6[1$[1${1̍L[ 1޶$ q1޶$[[[6[1޶$[1޶${1̍L[ 1$ 1$[[[6[1$[1${1̍L[ 3z$ 3z$[[[6[3z$[3z${1̍L[ 2d$ 2@%[[[6[2d$[2d${1̍L[ 2z$ 2z$[[[6[2z$[2z${1̍L[ 2$ 2$[[[6[2$[2${1̍L[ n24$ 24$[[[6[n24$[n24${1̍L[ c2$ c2$[[[6[c2$[c2${1̍L[ Y24$ ,G24$[[[6[Y24$[Y24${1̍L[ c2J$ c2no$[[[6[c2J$[c2J${1̍L[ 2:% 2:%[[[6[2:%[2:%{1̍L\ 22$% 22%\\\6[22$%[22$%{1̍L\ H2:% l2:%\\ \6\H2:%\H2:%{1̍L\ 22P|% 22tj%\\\6 \22P|% \22P|%{1̍L\ &J2$& \2$&\\\6\&J2$&\&J2$&{1̍L\ 3&2\2\4\60\^,3&/\^,3&{1̍L8\ t!3& t!3v&9\9\;\67\t!3&6\t!3&{1̍L?\ 3& 3&@\@\B\6>\3&=\3&{1̍LF\ t!3ƾ& t!3&G\G\I\6E\t!3ƾ&D\t!3ƾ&{1̍LM\ t2' 2'N\N\P\6L\t2'K\t2'{1̍LT\ i2!' i22'U\U\W\6S\i2!'R\i2!'{1̍L[\ ^2' M2'\\\\^\6Z\^2'Y\^2'{1̍Lb\ i2, ' i2P&c\c\e\6a\i2, '`\i2, '{1̍Li\ u.l& .l&j\j\l\6h\u.l&g\u.l&{1̍Lp\ j.V& j.2'q\q\s\6o\j.V&n\j.V&{1̍Lw\ `.l& .N.l&x\x\z\6v\ `.l&u\ `.l&{1̍L~\ j.& j.&\\\6}\j.&|\j.&{1̍L\ . .\\\6\.\.{1̍L\ . .\\\6\ .\ .{1̍L\ . D.\\\6\ .\ .{1̍L\ . .\\\6\ .\ .{1̍L\ @E.2) W.2)\\\6\@E.2)\@E.2){1̍L\ J@.7) J@.I)\\\6\J@.7)\J@.7){1̍L\ T;.2) x).2)\\\6\T;.2)\T;.2){1̍L\ J@.-) J@.)\\\6\J@.-)\J@.-){1̍L\ k.( ) }.( )\\\6\k.( )\k.( ){1̍L\ f.) f.)\\\6\f.)\f.){1̍L\ b.( ) *P.( )\\\6\b.( )\b.( ){1̍L\ f.2) f.V(\\\6\f.2)\f.2){1̍L\ k.\) }.\)\\\6\k.\)\k.\){1̍L\ f.va) f.Rs)\\\6\f.va)\f.va){1̍L\ b.\) *P.\)\\\6\b.\)\b.\){1̍L\ f.W) f.E)\\\6\f.W)\f.W){1̍L\ .Z) l/.Z)\\\6\.Z)\.Z){1̍L\ .z_) .Vq)\\\6\.z_)\.z_){1̍L] .Z) .Z)]]]6].Z)].Z){1̍L ] .U) .C) ] ] ]6 ].U)].U){1̍L] .( ) l/.( )]]]6].( )].( ){1̍L] .) .)]]]6].)].){1̍L] .( ) .( ) ] ]"]6].( )].( ){1̍L&] .2) .V(']'])]6%].2)$].2){1̍L-] w.xh% .xh%.].]0]6,]w.xh%+]w.xh%{1̍L4] r.nm% r.J%5]5]7]63]r.nm%2]r.nm%{1̍L;] m.xh% \.xh%<]<]>]6:]m.xh%9]m.xh%{1̍LB] r.c% r.Q%C]C]E]6A]r.c%@]r.c%{1̍LI] j0.% FB.%J]J]L]6H]j0.%G]j0.%{1̍LP] t+.% t+.%Q]Q]S]6O]t+.%N]t+.%{1̍LW] ~&.% .%X]X]Z]6V]~&.%U]~&.%{1̍L^] t+.% t+.%_]_]a]6]]t+.%\]t+.%{1̍Le] w.% .%f]f]h]6d]w.%c]w.%{1̍Ll] r.% r.%m]m]o]6k]r.%j]r.%{1̍Ls] m.% \.%t]t]v]6r]m.%q]m.%{1̍Lz] r.% r.%{]{]}]6y]r.%x]r.%{1̍L] J.% &.%]]]6]J.%]J.%{1̍L] T.% T.%]]]6]T.%]T.%{1̍L] ^.% .%]]]6]^.%]^.%{1̍L] T.% T.%]]]6]T.%]T.%{1̍L] j0.%% FB.%%]]]6]j0.%%]j0.%%{1̍L] t+.*% t+.<%]]]6]t+.*%]t+.*%{1̍L] ~&.%% .%%]]]6]~&.%%]~&.%%{1̍L] t+.!% t+.,%]]]6]t+.!%]t+.!%{1̍L] w.%% .%%]]]6]w.%%]w.%%{1̍L] r.*% r.<%]]]6]r.*%]r.*%{1̍L] m.%% \.%%]]]6]m.%%]m.%%{1̍L] r.!% r.,%]]]6]r.!%]r.!%{1̍L] J.%% &.%%]]]6]J.%%]J.%%{1̍L] T.*% T.<%]]]6]T.*%]T.*%{1̍L] ^.%% .%%]]]6]^.%%]^.%%{1̍L] T.!% T.,%]]]6]T.!%]T.!%{1̍L] J.zg% &.zg%]]]6]J.zg%]J.zg%{1̍L] T.pl% T.L~%]]]6]T.pl%]T.pl%{1̍L] ^.zg% .zg%^^^6]^.zg%]^.zg%{1̍L^ T.b% T.P%^^ ^6^T.b%^T.b%{1̍L ^ j0.zg% FB.zg%^^^6 ^j0.zg% ^j0.zg%{1̍L^ t+.pl% t+.L~%^^^6^t+.pl%^t+.pl%{1̍L^ ~&.zg% .zg%^^^6^~&.zg%^~&.zg%{1̍L"^ t+.b% t+.P%#^#^%^6!^t+.b% ^t+.b%{1̍L)^ 2,% `2,%*^*^,^6(^2,%'^2,%{1̍L0^ 2"% 2%%1^1^3^6/^2"%.^2"%{1̍L7^ 2,% ~2,%8^8^:^66^2,%5^2,%{1̍L>^ 26 % 2Z$?^?^A^6=^26 %<^26 %{1̍LE^ 2$ `2$F^F^H^6D^2$C^2${1̍LL^ 2$ 2$M^M^O^6K^2$J^2${1̍LS^ 2$ ~2$T^T^V^6R^2$Q^2${1̍LZ^ 2$ 2$[^[^]^6Y^2$X^2${1̍La^ -6) .6)b^b^d^6`^-6)_^-6){1̍Lh^ - ) -)i^i^k^6g^- )f^- ){1̍Lo^ -6) 8-6)p^p^r^6n^-6)m^-6){1̍Lv^ -Lv) -pd)w^w^y^6u^-Lv)t^-Lv)]1^u1DAGeGrG~GGGGGGGGGGGGGGGGGGHHHHH$H+H2H9H@HGHNHUH\HcHjHqHxHHHHHHHHHHHHHHHHHHHHI III I'I.I5ILELLLSLZLaLhLoLvL}LLLLLLLLLLLLLLLLLLLM MMMM%M,M3M:MAMHMOMVM]MdMkMrMyMMMMMMMMMMMMMMMMMM|^ ,, <5, <5& ,&~^}^}^}^}^^^^{1^|^MQOXO_OfOmOtO{OOOOOOOOOOOOOOOOOOOPPPPP#P*P1P8P?PFPMPTP[PbPiPpPwP~PPPPPPPPPPPPPPPPPPPQ QQQQ&Q-Q4Q;QBQIQPQWQ^QeQlQsQzQQQQQQQQQQQQQQQQQQQQR RRR"R)R0R7R>RERLRSRZRaRhRoRvR}RRRRRRRRRRRRRRRRRRRS SSSS%S,S3S:SASHSOSVS]SdSkSrSySSSSSSSSSSSSSSSSSSSST TTT!T(T/T6T=TDTKTRTYT`TgTnTuT|TTTTTTTTTTTTTTTTTTTUUUUU$U+U2U9U@UGUNUUU\UcUjUqUxUUUUUUUUUUUUUUUUUUUUV VVV V'V.V5V^ ,, :5, :5 , , ,^^^^^^^^51^^s?@@@@@@@@A AAA!A(A/A6A=ADAKARAYA`AgAnAuA|AAAAAAAAAAAAAAAAAAABBBBB^ ,, :5, >5 , :5 , , ,^^^^^^^^^^{1^^^E^L^S^Z^a^h^o^v^^ _>_@_TL4_{A_ ԑ&\' \'\' \'ԑ& ԑ&ԑ&C_B_B_B_B_D_E_F_VX4_4&&ZPS1_8_1t$\]H__H_d4&(#&@_H_b4&% X4_&&I_\]M__M_d&(#&@_M_b&% X4_D&&I_\]Q__Q_dD&(#&@_Q_bD&% X4_'&I_\]U__U_d'(#&@_U_b'% X4_T'&I_\]Y__Y_dT'(#&@_Y_bT'% X4_.'&I_\]]__]_d.'(#&@_]_b.'% X4_dB'&I_\]a__a_ddB'(#&@_a_bdB'% X4_U'&I_\]e__e_dU'(#&@_e_bU'% X4_ti'&I_\]i__i_dti'(#&@_i_bti'% X4_|'&I_\]m__m_d|'(#&@_m_b|'% X4_H'4&I__\]q__q_d'4&@_q_b (4& X4_H'&I__\]u__u_d'&@_u_b (& X4_H'D&I__\]y__y_d'D&@_y_b (D& X4_H''I__\]}__}_d''@_}_b (' X4_H'T'I__\]___d'T'@__b (T' X4_H'.'I__\]___d'.'@__b (.' X4_H'dB'I__\]___d'dB'@__b (dB' X4_H'U'I__\]___d'U'@__b (U'  X4_H'ti'I__\]___d'ti'@__b (ti'  X4_H'|'I__\]___d'|'@__b (|'  X4_|'H'I_ \]___d|'7'@__b|'['  X4_ti'H'I_ \]___dti'7'@__bti'['  X4_U'H'I_ \]___dU'7'@__bU'[' X4_dB'H'I_ \]___ddB'7'@__bdB'[' X4_.'H'I_ \]___d.'7'@__b.'[' X4_T'H'I_ \]___dT'7'@__bT'[' X4_'H'I_ \]___d'7'@__b'[' X4_D&H'I_ \]___dD&7'@__bD&[' X4_&H'I_ \]___d&7'@__b&[' X4_4&H'I_ \]___d4&7'@__b4&[' X4_&|'I_\]___d9&|'@__b&|' (X4_&ti'I_\]___d9&ti'@__b&ti' 'X4_&U'I_\]___d9&U'@__b&U' &X4_&dB'I_\]___d9&dB'@__b&dB' %X4_&.'I_\]___d9&.'@__b&.' $X4_&T'I_\]___d9&T'@__b&T' #X4_&'I_\]___d9&'@__b&' "X4_&D&I_\]___d9&D&@__b&D& !X4_&&I_\]___d9&&@__b&&  X4_&4&I_\]___d9&4&@__b&4& X4_& ^'\]___d&-'@__b&' )X4_&#'\]___d&'@__b&' +X4_&&\]___d&K'@__b&Vo' ,X4_#' ^'\]___d#'-'@__b#'' *X4_#'#'\]___d#''@__b#'' -X4_#'&\]___d#'K'@__b#'Vo' .X4_ ^' ^'\]`_`d ^'-'@_`b ^'' /X4_ ^'#'\]`_`d ^''@_`b ^'' 0X4_ ^'&\] `_ `d ^'K'@_ `b ^'Vo' 1A]4__4_ԑ&*'T#'#'M8c8cl^n^6_n^=_n^A_p^^N0680```^G2R201F``'o&Il`n`Mp``^!`'wV&Y]!`_!`b';t& _!`d##(Z%&@`]`_`k'*%_T`e]`_`b'զ& _`d##(&@'&``'&'0& (B&0(B&F(" 'F(%'D(8''D((&'F(V''+`K+`K+`K+`K+`K+`K+`K+`K+`K-`.`/`0`1`2`3`4`KG````F(V''H_]`_`dF(&@_`bF(&\& ^VCG;`;`;`^G2C9FA`@`(ܯ#Il@`n@`Mp@`?`@`^F`'ܯ#e]F`_F`b'#_ _F`d-($_@]@`_@`k'l#T_>`Y]?`_?`b(#_ _?`dec($_@H2(ܯ#;`$S`&S`)&S`+&S`-&S`/1 "2Y`$Z`&Z`)&Z`+&Z`-&Z`/1VQFNCC25917Z`9Z`;a`=a`11=a`22=a`33=a`44=a`55=a`66=a`77=a`88=a`99=a`1010=a`1111=a`1212=a`1313=a`1414=a`1515=a`1616 LGC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF.psl@2CC2591Bs`Ds`CC2591GC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF.sslCC2591RF291FS`R`K("H2CC2591JLw`{y` I&g' g'g' g'y& y&y& y&_'{`z`z`z`z`z`|`}`~``TLw`{` &`'  &`' ````TLw`{` I&_' _'_' _'I& I&I&````````VXw`f&E&ZPS1_2_2$,\]`_`df&&@_`bf&%  Xw`&E&`\]`_`d&&@_`b&%  Xw`.'E&`\]`_`d.'&@_`b.'%  Xw`'E&`\]`_`d'&@_`b'%  Xw`='f&`_\]`_`dl'f&@_`b'f& Xw`='&`_\]`_`dl'&@_`b'& Xw`='.'`_\]`_`dl'.'@_`b'.' Xw`=''`_\]`_`dl''@_`b'' Xw`'='` \]`_`d''@_`b'' Xw`.'='` \]`_`d.''@_`b.'' Xw`&='` \]`_`d&'@_`b&' Xw`f&='` \]`_`df&'@_`bf&' Xw`E&'`\]`_`d/&'@_`b(%' Xw`E&.'`\]`_`d/&.'@_`b(%.' Xw`E&&`\]`_`d/&&@_`b(%& Xw`E&f&`\]`_`d/&f&@_`b(%f&  Xw`,&<'ZStyle10`T\]`_`d,&+N'@_`b,&9h' Xw`H'<'`\]`_`dH'+N'@_`bH'9h' Xw`H' &`\]`_`dH')'@_`bH'C' Xw`,& &`\]`_`d,&)'@_`b,&C' ]w`_w`I&}x'T&&ƾM8c8clR`nR`y`nR``nR``pR`R`^`k(="`]`_`dk("@_`bk(! R`N0694````^G2L401F``Ö(! @]a_aksV';!T aY]a_abx(R!  _ad3(~! @Ö(ap!a(4!(lr!Ö(ap!a a a aa G```a`Ö(!e]`_`dB('A"_@_`bx(!_ ]`_`kd'l!T `Y]`_`d(s"_@_`bx(M."_ Ö("`a(="(^N"-(;"-("Ö("aLaLaLaLaLaaaaLG```]1`a(="`]`_`da("@_`ba(! R`;`aŞ(="`]a_adŞ("@_abŞ(! R`^a)(="`]a_ad)("@_ab)(! R`^aJ(^"`]a_ad )^"@_ab2)^" R`N0673aaaa^G4Faa)h1%IlanaMpaaaN0675aaaa^a_]a_ad_B)’'@_abJ)’' )’'a)J%).& ).& )H'l)Ȓ')')')’'aKaKaKaKaKaKaKaKaaaaaaaKGaaaa)J%e]a_abk)yh% _ad*6J%@]a_ak[)h#_TaY]a_abk)5% _ad*$@)%aJ("p("3)")t#)%aKaKaKaKaKaaaaKGaaaaJ("`]a_ad )"@_ab2)" R`N0672aaaa^G5Faaq)0%IlanaMpaaaN0674aaaa^a}_]a_ad_B):'@_abJ):' ):'aq)I%Wp)I%Wp)@r%+)%+)@'a)')')"~')"~'):'aKaKaKaKaKaKaKaKaKaKabbbbbbbbKGaaaaq)I%e]a_ab)g% _ad)nI%@]a_ak)#_TaY]a_ab)5% _ad)6$@q)S%aJ(&"-)R"W)|#W)h$q)$q)S%bKbKbKbKbKbKbbbbbKGaaaaJ(&"`]a_ad )&"@_ab2)&" R`N0678bbbb^G3F$b#b'-)02%Il#bn#bMp#b"b#bN0679+b+b*b+b^.by_]/b_/bd_B)k'@_/bbJ)k' )k'-b'-)}K%'-)(v%)%)`7'wZ)j')j')j')j')k'3bK3bK3bK3bK3bK3bK3bK3bK3bK5b6b7b8b9b:b;b#)(:#bLbLbLbbLGTbWbSbRb)(:#`]Rb_Rbd)(#@_Rbb)(# R``]b_bdŞ(#@_bbŞ(# R`N0668bbb^G2C303Fbb($IlbnbMpbbbN0670bbb^G2C301Fbb;j(`$IlbnbMpbb^bP(`$Y]b_bbn( C$ _bd(#@b]b_bk3'`I$Tbe]b_bbL( C$ _bd (#@(`$bb(`$( *$(($b b b bb bbb "2b$b&b2103&b410000pf&b510%&b316&b6AVX&b)&b+&b-&b/1SM0402SM04027b9b;c=c11=c220? ProLib.psl@2 CM05CG1035OATBcDcC Prolib.sslC,Capacitor, Surface Mount Multi-Layer CeramicG2L301Fbb($IlbnbMpbbbN0677cccc^cY_]c_cd(&@_cb(&\& (V''c(=$($/(%$/(%/(/%[(b('[((&'(V''cLcKcKcKcKcKcLcLccccc c!cLGcccc(=$e]c_cd($@_cbW($ ]b_bk[A'8$TbY]b_bd(d$@_bbW(g$ ($b(`$($($+c +c +c -c.c Gbbbbb(($e]b_bbW(E$ _bd('$@]b_bkK'p#TbY]b_bbW(?$ _bd(^#@({#bb({#(<#a(:#8cL8cL8cL:c;cLGbbbba(:#`]b_bda(#@_bba(# Q`R`;`@cG(#`]@c_@cd'#@_@cb'# R`N0667GcGcGc "2Nc$Oc&Oc2223&Oc422000pf&Oc5 +80% -20%&Oc325&Oc6AVX&Oc)&Oc+&Oc-&Oc/1SM0402SM04027Oc9Oc;[c=[c11=[c220? ProLib.psl@2 CM05CG2235OATB_cD_cC Prolib.sslC,Capacitor, Surface Mount Multi-Layer CeramicG2R401FMcLc3'@"IlLcnLcMpLcKcLc^fc'@"e]fc_fcb"}'#_ _fcde'xK#_@]Lc_Lck+h&"T_JcY]Kc_Kcb'#_ _Kcd'xK#_@'@"FcIc'@";(@"("~F("G(&"pcLpcLpcLpcLpcLrcsctcucLGGcJcFcEcG(&"`]Ec_Ecd'&"@_Ecb'&" R`^zcG("`]zc_zcd'"@_zcb'" R`;`cG(^"`]c_cd'^"@_cb'^" R`^c}(4#`]c_cd}(#K#@_cb}(1e# R`^cߢ(4#`]c_cdߢ(#K#@_cbߢ(1e# R`^cߢ("`]c_cdߢ(&#@_cbߢ(@# R`^c}("`]c_cd}(&#@_cb}(@# ]R`_R`%(uu#TP``]Q`_Q`dk(#@_Q`bk(# k(:#=`H2(ܯ#Y(ܯ#l(#l(=#5k(<#k(:#cLcLcLcLcLcLcccccL;`P`;`c'@e#Mc'@e#ck(:#o'(;#'@e#cLcLcLccL;`Ac;`^G2C10Fccc'#IlcncMpccc^c'#e]c_cbR't6#_ _cd'{#_@]c_ck;&@#T_cY]c_cb't6#_ _cd(({#_@'#cG(#'#'#cLcLcLccL;`AcccG(#G(3#'@e#cLcLcLccL;`;`^G2C12Fcc(N"IlcncMpccc^c(N"e]c_cb)0" _cd(!@]c_ck(p!TcY]c_cbF(0" _cde(!@(N"ac(N"߻(N"˝(l"˝(7"Ş(="cLcLcLcLcLccccL;`c;`c("Mc("c(N"($"("c c c cc ;`;`cK'(McK'(;`^G2C2Fcc'\'IlcncMpcc^c΅'\'Y]c_cb'' _cdT'$'@c]c_ck&((Tce]c_cb,'' _cd'$'@h'\'cK'('(h'\'cÀcpcZcZccÀcp;`c;`^d_]d_ddK''@_db '' )('dh'\'\'h'u'h's'j'(('i((')('dÀ Power Min_1 dKdKdKdKdKdd d d d dddd;`;`^G2C1Fdd)(IldndMpddd^d)i(e]d_dbk%)-( _ddj)(@]d_dkO(9(_TdY]d_dbk%)( _ddj)4(@)e(;`^$d_]%d_%dd(Y(@_%db(g( ((d)e(O)wc(O)D((84((((((()dK)dK)dK)dK)dK)dK)dK+d,d-d.d/d0dK;`d;`2d?)[(M2d?)[(1d)e( 6)e(?)[(4d 4d 4d 6d7d ;`c;`^G2C11Fe?e@eAeBeCeDeEeFeGeLG2e1e5e0ea%+]0e_0edl%+@_0ebl%~+ d^Le%+]Le_Led%+@_Leb%~+ dN0664SeSeReSeVep$^*MVep$^*Ue8$p*8$\*[l$^*p$^*XeLXeLXeLXeLZe[e\eLSeSe^e;'^*M^e;'^*Se^`e_]ae_aed(Y(@_aeb(g( ((]e;'^*'*(*<)4=*<)g)g((((((((eeKeeKeeKeeKeeKeeKeeKeeKeeKgeheiejekelemeneKSeVe^eoep$^*;'^*peLpeLreLGSe^eVeRe`eQe8$p*]Qe_QedB$*@_QebB$+ dN0663yeyexeye|e$4*M|e$4*{e;$p*;$*$ j*$4*~eL~eL~eL~eLeeeLyeyee{v'1*Me{v'1*ye^e_]e_ed(Y(@_eb(g( ((e{v'1*'*(*%)D2*%),n)߻(P) (( ((((eKeKeKeKeKeKeKeKeKeeeeeeeeKye|eee$4*s'4*{v'1*eLeLeLeeLGyee|exeewe;$p*]we_wed%$*@_web%$+ dN0662eeeeeN%*MeN%*es$p*s$(X*N%*eLeLeLeeLeee'*Me'*e^e_]e_edu(Y(@_ebu(g( u((e'*?(y*?(p~*(y*(y*3)(*3)Hz)W(l)((((u((eKeKeKeKeKeKeKeKeKeKeKeeeeeeeeeeKeeeeN%*'*eLeLeLGeeeeees$p* ]e_ed] %*@_eb] %+ dN0660eeeee%'Me%'ea%p*a%*=%vl*=%"(9%(9%'%'eLeLeLeLeLeLeLeeeeeeLeeeS&&(MeS&&(e^e_]e_edK'’'@_eb '’' )(’'eS&&(&'''''(('i((')(’'eKeKeKeKeKeKeKeeeeeeKeeee%'%(S&(S&&(eLeLeLeLeeeLGeeeeeea%p*$]e_edl%*@_ebl%+ d]d_dk#v*Td(]d_dd%*@_db%+ %p*dc&\*%\*%p*eeeee;`;` "2e$e&e)&e+&e-&e/1SOTAP72157e9e;f=f41=f32=f23=f14ELGC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF.psl@2AP7215B fD fAP7215-33YG-13GC:\Documents and Settings\All Users\Documents\PCB Artist\Library\RF.sslVRVR2FeeWI#%H2AP7215JLf{f К&c' ^'c' ^'T& К&T& К&& && && К&&ffffffffffffffffTLf{f H&w' q'w' q'q& H&q&ffffffffVXf&&ZPS1_4_2'6\]!f_!fd&6&@_!fb&% Xfx&&"f\]&f_&fdx&6&@_&fbx&% Xf7'&"f\]*f_*fd7'6&@_*fb7'% Xfx&p''Z PS1_1_3_1PF`m \].f_.fdx&I}'@_.fbx&' ]f_fH&R'Tx&&DL8c8clenefnefpee^9f#h%!f]9f_9fd#$@_9fb#$ eN0688@f@f?f@feCf.f]Df_DfdWI#I$&@_DfbWI#=& WI#p%BfWI#h%WI#p%HfHfJf@f?f@f "2Pf$Qf&Qf2334&Qf4330nf&Qf510%&Qf316&Qf6AVX&Qf)&Qf+&Qf-&Qf/1SM0805SM08057Qf9Qf;]f=]f11=]f220? ProLib.psl@20805YC334KATEABafDafC Prolib.sslC,Capacitor, Surface Mount Multi-Layer CeramicG2C117FOfNf"($ lNfnNf pNfNf^hf"o$ ]hf_hfb#$ _hfdL#1$@Mf]Nf_NfkG"#_TLf ]Mf_Mfb#!$ _MfdL#$@"]$KfWI#h%H#h%H#d$##$&"$"]$rfrfN rfrfrfrftfufvfwfxf@f@f "2~f$f&f)&f+&f-&f/1USERSWITCH_CK_JS202011CQN]LHC:\Documents and Settings\Jeff\My Documents\Downloads\Connectors (1).psl@2COMPUU1F}f|fg]"G#p|f|fN0690fff|ff]f_fd""@_fb"D%# !#ff!#!h#ffffff "2f$f&f)&f+&f-&f/1USERDC_MOLEX_A-5569-02A2G7f9f;f=f-1=f-1=f-1lL5C:\Documents and Settings\Ting\Desktop\Connectors.psl@2PWRVV3Fffo! ( pff ]f_fdf!ά( @_fbf!Fq(  f^fo!q' ]f_fdf!' @_fbf!T'  f]f_fo! ( T f ]f_fdf!θ& @_fbf!F}&  o! &f!h#!Tp%u"Tp%l"%l" e&6" &o! &ffffffffffffffff^G2C13Fff"~&IlfnfMpfff^f"&e]f_fbG="& _fd"L&@]f_fk+"z&TfY]f_fbG="& _fd"m&@"1&fo! &\" &"1&fffffGffffff!h#]f_fd"j#@_fb",# {f|fN0689fff|ff]f_fd""@_fb"D%# "#ff"#"h#ffffff^G2C14Fff?"!IlfnfMpff^fBY"!Y]f_fb~;"n!_ _fd_"/"_@f]f_fkaG"!T_fe]f_fb"n!_ _fd''"/"_@&"!f"#"#" "%"&"%"!&"b!&"!ffffffffffgggfff "2g$ g& g)& g+& g-& g/1USERUSB_B_F7 g9 g;g=g-1=g-1=g-1=g-1=g-1=g-1L5C:\Documents and Settings\Ting\Desktop\Connectors.psl@2USBCONNCONN4Fgg! !5pgg7]g_gd'(!\n @_gb'(! g<]g_gdw"\n @_gbw" g^#g! @]#g_#gd{!8 @_#gb{!! gg^(g_&" I](g_(gd#D"8 @_(gb#D"! gN0657/g/g/g^G2R102F5g4gO(T(l4gn4gp4g3g4gN0683gO((O((U( (U( (k(x(k((k((m((DgKDgKDgKDgKDgKDgKDgKDgKFgGgHgIgJgKgLgK)MgO(>)1gO()O(>)gLgLgL/gg/ggks!p%Mgks!p%gO(>)%>)ks!p%gLgLgLggL/gg/gKgks!"gks!"gks!p%ks!"gLgLgL/g/g^G2USB2Fggό!*"IlgngMpgg^g!*"Y]g_gbX!"_ _gd9!b2#_@g]g_gkW "T_ge]g_gbU!"_ _gdt!b2#_@s!*"ggs!*"s!"ks!"gLgLgLggL/gg.ggks!"v!"v!"s!"s!,!!D!!D!gLgLgLgLgLgLgLggggggLG/gggg2gg.gJ-g!D!M]-g_-gd{!X&!@_-gb{!a! ]g_g! !TgE]g_gd#D"X&!@_gb#D"a! _&"D!g&"!&"eD!_&"D!gggggGffffgf"h#]f_fd"j#@_fb",# f|f@fgg]"#]g_gd+{""@_gb+{"D%# f]|f_|fg]"G#Tzf]{f_{fd+{"j#@_{fb+{",# g]"h#gyfg]"h#g]"#ggg@fzfLfgg]"h#g]"L$_"D$V"D$o"]$"]$gggggggggggG@f?fCfLfzfg>fWI#h%&f]>f_>fdWI#$@_>fbWI#$ eDf]e_e#%Te*f]e_ed#$@_eb#$ #h%;` "2g$g&g2474&g316&g4470nf&g510%&g6AVX&g)&g+&g-&g/1SM0805SM08057g9g;g=g11=g220? ProLib.psl@20805YC474KATEABgDgC Prolib.sslC,Capacitor, Surface Mount Multi-Layer CeramicG2C114FggY# $ lgng pgg^gY#p$ ]g_gb#$ _gd#2$@g]g_gk##_Tg ]g_gb#$ _gd#$@Y#A$e#h%]#h%]#$#A$Y#A$hÀ h2hÀStyle3_1(#hhhÀStyle2_22hh h h h hÀh2;`g;`Kh#º$h#º$hY#A$#A$#º$#º$hhhhhhh;`;`gG2C118FhhD$($ lhnh phh^#hD$o$ ]#h_#hbGb$$ _#hd$1$@h]h_hk$\#_Th ]h_hbGb$!$ _hd$$@D$]$hhD$]$9$]$9$º$#º$-h-h-h-h/h0h1h;`h;`3h#(%M3h#(%2h#º$#º$#F$#D$#(%5h5h5h5h5h7h8h9h:h;`;`h>h>h@hAh;`h`P`Acccacdd$dc9dYdkddd:`dddeghJhUh_hvhh;`̍Lh :'C, C, i=i=i?i֍h "  o%# Ai@i@iBi֍h w")  ") DiCiCiEi֍h "!  1 #! GiFiFiHi֍h "~'  9#~' JiIiIiKi֍h "h*  G:#h* MiLiLiNi֍h _#(  M#( PiOiOiQi֍h +#pp$  ^#pp$ SiRiRiTi֍h #,"  b#," ViUiUiWi֍h 2#h&  y#h& YiXiXiZi֍h =#`!  e#`! \i[i[i]i֍h @##  ## _i^i^i`i֍h z#!  7#! biaiaici֍h ##"  ##" eididifi֍h ֯#,  0$, higigiii֍h #(%  K$(% kijijili֍h #$  U$$ nimimioi֍h #pp$  W$pp$ qipipiri֍h #!!  })$!! tisisiui֍h # #  w,$ # wivivixi֍h $_#  sN$_# ziyiyi{i֍h 9$L!  a$L! }i|i|i~i֍h '$)  Co$) iiii֍h ($H&  op$H& iiii֍h 1E$\| ?$(  I$( t $WZ ܪ$,*@ ^$ +@ $,iiiiiiiiiiiiii֍h L$^*  _$^* iiii֍h R$B'  7$B' iiii֍h $!  $! iiii֍h c$4*  $4* iiii֍h $!  G%! iiii֍h o$Fď Q$  "% % %8 S%,*@ % +@ $,&Riiiiiiiiiiiiii֍h /$)  0%) iiii֍h )%!  J%! iiii֍h *%*  ?r%* iiii֍h }@%!  %! iiii֍h gz%Y i%  % ]%v M%L*@ 4%,*@ M% +@ fd%,)iiiiiiiiiiiiiiii֍h c%%  %% iiii֍h ;%'  %' iiii֍h %:&  %:& iiii֍h %(+%  %(+% iiii֍h %"  w&" iiii֍h %p#  O&p# iiii֍h S%ԑ+  $&ԑ+ iiii֍h %Y'  %&Y' iiii֍h %\*  (&\* iiii֍h -$&, A&$  Y&$  H&Q l_&,   &,iiiiiiiiiiii֍h +&  s& iiii֍h 2&j$  z&j$ iiii֍h G&T]!  g&T]! iiii֍h d&&(  &&( iiii֍h f&)  &) iiii֍h wm& +  & + iiii֍h 1v&+  a&+ iiii֍h ǁ&#  7&# iiii֍h {&  (' iiii֍h {&$  ('$ iiii֍h c'^*  ^'^* iiii֍h ''  e'' iiii֍h #'l+  j'l+ jiij֍h {,'&  s'& jjjj֍h 1'!  x'! jjjj֍h OD',;%  ',;%  jjj j֍h E'  '  j j j j֍h X'U&  'U& jjjj֍h {w'l"  'l" jjjj֍h ~'&  '& jjjj֍h ~'Dv'  W'Dv' jjjj֍h '*W R'1*  3'1*1 Q')*V K'*  ۀ'*1jjjjjjjjjjj j֍h K'<%  '<% "j!j!j#j֍h y''  '' %j$j$j&j֍h '(  (( (j'j'j)j֍h '+  5(+ +j*j*j,j֍h Q'@e#  "(@e# .j-j-j/j֍h '  ;P( 1j0j0j2j֍h '/+  K,(/+ 4j3j3j5j֍h '@@%  ?.(@@% 7j6j6j8j֍h 'Rk(  0(Rk( :j9j9j;j֍h '  5( =jj֍h (|!  K^(|! @j?j?jAj֍h 5()  cs(>) FjEjEjGj֍h +()  cs() IjHjHjJj֍h ,(#  +t(# LjKjKjMj֍h 2(F'  `(F' OjNjNjPj֍h 3(H'  a(H' RjQjQjSj֍h 4('  b(' UjTjTjVj֍h 5(2}'  c(2}' XjWjWjYj֍h >(&  K(& [jZjZj\j֍h SE(&  s(& ^j]j]j_j֍h E(0d%  +(0d% aj`j`jbj֍h U("  U(" djcjcjej֍h U(#  U(# gjfjfjhj֍h h(N'  /(N' jjijijkj֍h h(0~'  /(0~' mjljljnj֍h h('  /(' pjojojqj֍h h(Z'  /(Z' sjrjrjtj֍h iy(^"  (^" vjujujwj֍h (#  (# yjxjxjzj֍h ("  (" |j{j{j}j֍h ('  (' j~j~jj֍h (\'  (\' jjjj֍h (ܨ  w(ܨ jjjj֍h (Lj&  (Lj& jjjj֍h _(|5!  (|5! jjjj֍h _(!  (! jjjj֍h ("  (" jjjj֍h (`f'_ (2}'  (2}'_jjjjjj֍h (`f'_ (O'  (O'_jjjjjj֍h (#  S)# jjjj֍h (()v (0*  (0*i ()u ))  w()jjjjjjjjjjjjj֍h ('  K)' jjjj֍h (L'  K)L' jjjj֍h (0~'  I)0~' jjjj֍h (G'  E )G' jjjj֍h  )9&A )x &  oR)x &k ')g%A k))(%  ((%ljjjjjjjjjjjj֍h )%  cT)% jjjj֍h )]"  WV)]" jjjj֍h K)X"  V)X" jjjj֍h 1)[(  d)[( jjjj֍h [)+  d)+ jjjj֍h #)(, c)(( #)(, (p((jjjjjjjj֍h O<)&H W )& B)': A)'  )' S)&: T)&( 5T)O&ڪ )&  ;)&+jjjjjjjjjjjjjjjjjjjj֍h wp)'  )' jjjj֍h )(  {)( jjjj56h:'C,h:'C,;`̍Lj (@e# "(@e#jjj56j(@e#j(@e#;`̍Lj 'w# '#jjj56j'w#j'w#;`̍Lj +'@e# Q'@e#jjj56j+'@e#j+'@e#;`̍Lj 'dS# '@#jjj56j'dS#j'dS#;`̍Lj (" ("jjj56j("j(";`̍Lk (%" (v8"kkk56k(%"k(%";`̍L k (" (" k k k56 k("k(";`̍Lk (" ( !kkk56k("k(";`̍Lk qu(& K(&kkk56kqu(&kqu(&;`̍Lk c(^& c(8& k k"k56kc(^&kc(^&;`̍L&k Q(& >(&'k'k)k56%kQ(&$kQ(&;`̍L-k c(& c(̱&.k.k0k56,kc(&+kc(&;`̍L4k ''( ((5k5k7k563k''(2k''(;`̍L;k K'#( K'r6(k56:kK'#(9kK'#(;`̍LBk o'( '(CkCkEk56Ako'(@ko'(;`̍LIk K'' K''JkJkLk56HkK''GkK'';`̍LPk Q)[( d)[(QkQkSk56OkQ)[(NkQ)[(;`̍LWk ?)m( ?)(XkXkZk56Vk?)m(Uk?)m(;`̍L^k .)[( 1)[(_k_kak56]k .)[(\k .)[(;`̍Lek ?)J( ?)>7(fkfkhk56dk?)J(ck?)J(;`̍Llk N(%4_TmY]m_mbaG%! _mdՌ% @)%!mm)%!)%[*%,mLmLmLmmLGmmm]1m[*%,j]m_mdH%h@_mbH% ll^m?6&,r]m_mdT&h@_mbT& ]l_l#Tln]l_ld%h@_lb% %,ll%,%bP d%ʾ d%}!c%K!mLmLmLmLmLmmmmLGlllJlc%K!Y]l_lb% ! _ld %. @l]l_lkx%_Tle]l_lb%R! _ld %f4!@c%4!llc%4!c%\!5d%!mKmKmKmmKGlllll]1l)J'_]l_ld_B)J'@_lbJ)J' memm^^m)j'_]m_md_B)j'@_mbJ)j' %deaeee^N0682nnn^G2R101F nn(t)lnnnpnnn^n(.*]n_nb(* _nd(B)@]n_nkc()Tn]n_nb(~) _nd( )@()n^G2C101Fnnϭ({)IlnnnMpnnn^ n({)e] n_ nb(^) _ nd()@]n_nk(,)TnY]n_nbF(^) _ndec()@({)n()(Q})({)*nL*nL*nL,n-nLnnnK/n(>u(/n(>u(.n({)(>u(1nK1nK3nKnn^5n_]6n_6nde(Y(@_6nbe(g( e((/n4ne(((`((>u(:nK:nK:nKn(>u((K(((?nK?nK?nKAnBnKGn/nnn5nnn((_]n_nd(Y(@_nb(g( 6n@g^^^GnF((_]Gn_GndF(Y(@_GnbF(g( ^N0681NnNnNn^G2C201FTnSn'=(IlSnnSnMpSnSn^Yn΅'=(Y]Yn_Ynb'T( _YndT''@Rn]Sn_Snk'X&3(TQne]Rn_Rnb,'T( _Rnd''@h'=(MnPnh'=(c(=('(%('('((R'i((R')(j'cnKcnKcnKcnKcnKcnKcnKenfngnhninjnKGNnQnMnLn)(j'_]Ln_LndK'j'@_Lnb 'j' d^^on)(Z'_]on_ondK'Z'@_onb 'Z' ^^tn)(ҹ'_]tn_tndK'ҹ'@_tnb 'ҹ' ^^yn)(J'_]yn_yndK'J'@_ynb 'J' e6e^^~n)(k'_]~n_~ndK'k'@_~nb 'k' ^^n)(*X'_]n_ndK'*X'@_nb '*X' d^^nb('_]n_ndb(8(@_nbb([( ^^nb('_]n_ndb('@_nbb(\!( ^^nb(^`'_]n_ndb(k'@_nbb(' ^^n!('_]n_nd!(8(@_nb!([( ^^n!('_]n_nd!('@_nb!(\!( ^^n!(^`'_]n_nd!(k'@_nb!(' ^^n('`]n_nd(8(@_nb([( ^^n('`]n_nd('@_nb(\!( ^^n(^`' `]n_nd(k'@_nb(' ]^_^m (H(T^_]^_^dUZ(Y(@_^bUZ(g( UZ((^(*'=)'*({X(](cX((cX((UZ((nKnKnKnKnKnKnKnnnnnnKG^^^^^N(H*]^_^bMl(Lf* _^d%(>*@]^_^k'pe*T_^]^_^b(Lf* _^d( *@(H*n^(H*(,*(.*nLnLnLnnL^$g^n! #!  *! "a "a V"nnnnLnLnLnnnnn^^nc(0*Mnc(0*^nc(0*c(<*?(O*i(O*(H*nLnLnLnLnLnnnnL^^^n %Mn %na V"a d% %nnnLnn^nnn %$t{)?(t{)c(0*nLnLnLnLnnnLG^nn^n$g^^a V"Y]^_^b "_ _^d~!!3#_@^]^_^k; "T_^e]^_^b "_ _^dF 3#_@ǽ V"^nJ "MnJ "^ǽ V"| V"J "nlnlnlnnl^g^nm""Mnm""n!*"?!*"m""nlnlnlool^f^oy"!Moy"!oBY"!{"!y"!ooolo o^a*a ob(4!b(! ol ol ol^*aAaob(!b(f b(f b( ololololoool^"`ho'wV&'wV&?'V&olololool^hhho?'V&7(V&ololol^hhho7(V&or(V&olol ol^"`^"oW|'U&M"oW|'U&!o'wV&|'wV&W|'U&$ol$ol$ol&o'ol^G`^)osP(#M)osP(#(o'ܯ#'## (T#N(T#sP(#+ol+ol+ol+ol+ol-o.o/o0ol^{c^2o3'l"M2o3'l"1oG("("['l"3'l"4oL4oL4oL4oL6o7o8oL^gc2o9o'@"'"3'l":ol:ol:olo'@"'# '#N'#'#?ol?ol?ol?ol?olAoBoCoDol^Bd2oEo'"'͊"3'l"FolFolFolHoIol^Bd^Ko:(|!MKo:(|!Jo'"'W"7'p>p>p@pAp^uapaBp'& '`CpCpEp^kafaFpc|(`c|(& GpGpIp^^Kp)(%MKp)(%2lJp)(%)&(&(V('(8''((&'(V''MpKMpKMpKMpKMpKMpKMpKOpPpQpRpSpTpK^^Vp3'$MVp3'$KpUp3'$'H$]'H$m((%)(%XpLXpLXpLXpLXpLZp[p\p]pL^oVp^pV&$&$%&$3'$_p _p _p _p apbpcp ^pddp0)%(%(%(K%/(%eplepleplepleplgphpipjpl^Me^lp &ԑ+Mlp &ԑ+kp%+%+ &ԑ+npnpnpppqp^$h^sp#pp$Msp#pp$rpD$o$#o$#pp$upupupwpxp^^zp"f%Mzp"f%:fyp"f%#f%#h%|pl|pl|pl~ppl^if^p:#pp$Mp:#pp$p"o$f:#o$:#pp$ppppp^gppY#p$J;#p$:#pp$ppppp^gsppY#p$8#p$#pp$ppppp^Lm^pc$( Mpc$( p;<$,;<$c$( plplplppl^m^p $ Mp $ p$,$ $ plplplppl^^p9% Mp9% mp9% 9%%,plplplppl^^p5&$ Mp5&$ mp5&$ 5&r?6&,plplplppl^lopW&%W&$V&$plplplppl^lop&%&xW%&9%f'9%h',;%plplplplplppppl^l^p%%Mp%%pW&%B%%%%plplplppl^aKopb(4!b(!:(|!plplplppl^Aa^p9( Mp9( pb( 7( 9( plplplppl^^p(O'ZStyle6p(O'^Kp(^`'p(^`'p(O'(^`'pLpLpL^n^Kpb('pb('pb('b('pLpLpL^n^Kp]('p]('pb(']('pLpLpL^n^Kp('p('p!('('pLpLpL^n^Kp('p('p('('pLpLpL^nnp('!('pLpLpL^nnp!('!('pLpLpL^nnpb('!('pLpLpL^nnp!('!(^`'pLpLpL^n^Kp[(^`'p[(^`'p!(^`'[(^`'qLqLqL^n^Kqb(.'qb(.'qb(^`'b(.'qLqLqL^n^K q(0~' q(0~' q('('('(0~' qL qL qL qLqqqL^npq(^`'(^`'qLqLqL^pnq(^`'!(^`'qLqLqL^^q](N'pq](N'pq](N'](`_'[(^`'qLqLqLqqL^pn q[(^`'b(^`'!qL!qL#qL^^%qI(F'p%qI(F'n$qI(F'I(G'b(^`''qL'qL'qL)q*qL^^,qL(2}'p,qL(2}'q+qL(2}'`(2}'b(.'.qL.qL.qL0q1qL^qn2qb(.'b('3qL3qL5qL^^7q](0~'p7q](0~'n6q](0~'[(0~'!('9qL9qL9qL;qq('p>q('=q!('('('@qL@qL@qLBqCqL^n^Eq]('pEq]('Dq!('#(']('GqLGqLGqLIqJqL^nEqKq!('!(']('LqLLqLLqLNqOqL^n>qPq!('!('('QqLQqLQqLSqTqL^n>qUq('('('VqLVqLVqLXqYqL^n>qZq('('('[qL[qL[qL]q^qL^n^`q(2}'p`q(2}'_q(^`'(2}'bqLbqLdqL^n`qeq('('(2}'fqLfqLfqLhqiqL^n`qjq!('(2}'kqLkqLmqL^n`qnq!(^`'(^`'(2}'oqLoqLoqLqqrqL^n7qsqb(^`'b(\a'](0~'tqLtqLtqLvqwqL^n7qxq!(^`'!(l`'](0~'yqLyqLyqL{q|qL^n7q}qb('b('](0~'~qL~qL~qLqqL^^qK('pqK('nqK('K('b('qLqLqLqqL^nqqb('b('K('qLqLqLqqL^pnqb('b('qLqLqL^pqqb('M('K('qLqLqLqqL^n,qqb(^`'b(lg'L(2}'qLqLqLqqL^n,qqb('b('L(2}'qLqLqLqqL^n^qJ(H'pqJ(H'qb('b('J(H'qLqLqLqqL^n^q](Z'pq](Z'qb('l('](Z'qLqLqLqqL^pnq]('!('qLqLqL^pqq]('](Z'qLqLqL^nqq!(')('](Z'qLqLqLqqL^n^qy(L'pqy(L'q('('y(L'qLqLqLqqL^n^q(\'pq(\'q('('(\'qLqLqLqqL^nqq!('('(\'qLqLqLqqL^pnq('('qLqLqL^pqq('(b'(\'qLqLqLqqL^^qy('pqy('nqy('y(μ'('qLqLqLqqL^nqq('('y('qLqLqLqqL^pnq('('qLqLqL^pqq('}('y('qLqLqLqqL^n^qw(0~'pqw(0~'q('('w(0~'qLqLqLqqL^ qnq(0~'(No'(No'(^`'qLqLqLqLqqqL^ qqq(0~'w(0~'qLqLqL^nqq(^`'(rd'w(0~'qLqLqLrrL^n^rs(G'prs(G'r(^`'(^`'s(G'rLrLrLr rL^np r(^`'(^`'(O' rL rL rL rrL^npr!(^`'(^`'(O'rLrLrLrrL^nqr!(^`'+(^`'](N'rLrLrLrrL^nqrb(^`'m(^`'](N'rLrLrLrrL^nEqrb('b(']('rLrLrL!r"rL^nEq#rb('b(']('$rL$rL$rL&r'rL^c^)r;(^"p)r;(^"(rߢ(4#ߢ(#;(^"+rL+rL+rL-r.rL^c)r/r}(4#}(#;(^"0rL0rL0rL2r3rL^c)r4r}("}(";(^"5rL5rL5rL7r8rL^c)r9rߢ("(";(^":rL:rL:rLrߢ(4#(4#(#ArLArLArLCrDrL^c^Fr("pFr("Erߢ("{("("HrLHrLHrLJrKrL^c^Mrl("pMrl("Lr}("}("l("OrLOrLOrLQrRrL^c^Trl(#pTrl(#Sr}(4#}(#l(#VrLVrLVrLXrYrLG^nno"o^[rF'l+M[rF'l+^]r+" +M]r+" +^_r#h*M_r#h*^ar[!zU)Mar[!zU)^crL$H&McrL$H&^er*#(Mer*#(^grw"((Mgrw"((^ir>!*Mir>!*^kr Za+Mkr Za+^mri &Mmri &^or%:&Mor%:&^qr$ #Mqr$ #^srKd##MsrKd##^urg##"Murg##"^wr7X %Mwr7X %^yrf L$Myrf L$^{r[k #M{r[k #^}r? !M}r? !^r*$_#Mr*$_#^r#!Mr#!^r (Mr (^rU#h&MrU#h&o^rK%(+%MrK%(+%^r%p#Mr%p#^rk&T]!Mrk&T]!^r&#Mr&#^r%"Mr%"^r=$L!Mr=$L!^r$!!Mr$!!#,"Mr>#,"^r !"Mr !"^ra#`!Mra#`!^r+!nO"Mr+!nO"^r!/#Mr!/#^r[3!B!Mr[3!B!^r5!%Mr5!%^r-"$'Mr-"$'^r\"|(Mr\"|(^rc#~'Mrc#~'^rG"'MrG"'^r )Mr )^rv$B'Mrv$B'^r3P'&Mr3P'&^rK$)MrK$)^r/")Mr/")+p^r3H )Mr3H )^r/& +Mr/& +^r(/+Mr(/+lp^rA)+MrA)+^rO&)MrO&)^r %)Mr %))oKo2oYo`opoooo pp$pKpVpsppzpppppEq>q7q`qqqqp,q%qqqqqqr)r?rFrMrTroooppppppq q^gfa*aAa"`hhhhG`{cgccBd`acambbVloHnznunpncZnndnlbddm!n^ffkg)guapakafa2lodMe$h:fifgLmmmmlllnnnnnnnnncccc^BR1FrrO',prrr^rq(+]r_rd5!(+@_rb5!(v, r^rU'm,]r_rdas'P,@_rbas', ]r_rO',Tr]r_rd&+@_rb&v, ɧ&+rr^̍Lr ">+' m"' #W' "q'rrrrrrrr6r">+'r">+'^̍Lr (C'$<, $<, s?s@sAs֍r ! )  n ) CsBsBsDs֍r &$ "  q " FsEsEsGs֍r 1 %  ~ % IsHsHsJs֍r ? L$  ] L$ LsKsKsMs֍r B &  [ & OsNsNsPs֍r D #  # RsQsQsSs֍r \ (  E ( UsTsTsVs֍r !  ! XsWsWsYs֍r m )  ) [sZsZs\s֍r % Za+  Za+ ^s]s]s_s֍r #  \! as`s`sbs֍r 1% !>[& ?! &  ! &T ;!& $)ȯ $ɐ) $ɐ)s 5$)  3%)r C)%ɐ) 6(ɐ) e_(])= (()  ]v()] s() R(J */) (0*  (0* (^) ))  }()S (n) N(^l)ȯ ?(f) $f) !#Ӣ' ;#' i%M)ȯ %S) 0(S)8 _u(>)6p p(e,) %)e,)ȯ 5)%) P) )ȯ V)T( V)( e)( $)˻( (p( F$){( ')( ?)( k%( $U( $"= $!  $!> $" $_'6* O$B'6* $% ( $j_( $o( Q%%)7 xV%/)) U%/)) |!V%.) !p%  M!p% Qz!% "& }"c& !%.) Y! %  %dscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscscsesfsgshsisjskslsmsnsospsqsrssstsusvswsxsyszs{s|s}s~sssssssssssssssssssssssssssssssssssssssss֍r ! /#  F!/# ssss֍r =!nO"  R!nO" ssss֍r !B!  Z!B! ssss֍r !%  e\!% ssss֍r I!*  e!* ssss֍r (!$  -v!$ ssss֍r g!zU)  !zU) ssss֍r W!"  !" ssss֍r L! ! !D!  !D! "! ! !  ! ssssssssssss֍r !q'  >!q' ssss֍r !#  g'"# ssss֍r !h#  g'"h# ssss֍r !"  +"" ssss֍r s! (  k(! ( ssss֍r c!6r'  H"6r' ssss֍r q"Zw  O"Zw ssss֍r "!i /!D!  Q"D!h 9"! R"  1! ssssssssssss֍r 1"#  "# ssss֍r 1"h#  "h# ssss֍r 6"|(  m"|( ssss֍r yY" +  ݦ" + ssss֍r o"'  "' ssss֍r v"((  )"(( ssss֍r }"f%  i"f% ssss֍r s"  2# ssss֍r g"#  "# ssss֍r g"h#  "h# ssss֍r }")  #) tttt֍r "!  +##! tttt֍r "h*  A=#h* tttt֍r e#(  P#(  t t t t֍r 1#pp$  a#pp$  t t tt֍r #,"  }e#," tttt֍r %/#h&  |#h& tttt֍r :#`!  _#`! tttt֍r =##  ## tttt֍r w#!  1#! tttt֍r ##"  ##" ttt t֍r ֯#,  0$, "t!t!t#t֍r #(%  I$(% %t$t$t&t֍r #!!  w,$!! (t't't)t֍r # #  q/$ # +t*t*t,t֍r #$6  #$  S$$5  '#$! Q$pp$  #pp$!.t-t-t-t-t-t-t/t0t1t2t3t֍r $_#  mQ$_# 5t4t4t6t֍r ?$L!  d$L! 8t7t7t9t֍r $$)  =r$) ;t:t:tt=t=t?t֍r @$?f <$(  C$( dl Ѕ$$I ܪ$,C: _$$= $,xAt@t@t@t@t@t@t@tBtCtDtEtFtGt֍r $H*8 J$^*8 $Ys* 'Ys*8 `'^*=O x^'P* '1*D t'-* G'*8 |') m%)8 (%*W 0%G* 2$G*8 g$4*} 1$H*ItHtHtHtHtHtHtHtHtHtHtHtHtHtHtHtHtJtKtLtMtNtOtPtQtRtStTtUtVtWtXt֍r m$= W$  %%  %rܣ S%,C: 9%$= $,=ZtYtYtYtYtYtYtYt[t\t]t^t_t`t֍r k%! ?'ʛ#ȯ )N' # ( #|+ (#  M)#z+ ( # q) # ~)r$ ~)&2 :)& :)&Pe ))8& (l&\ (Lj&  (Lj&[ (Ky& ,'Ky&9 'U&  U'U&: l'Ky& &Ky&ȯ ۸&& +&2'$v %Y'  {)&Y'1 (&Q' && (&  )&  )& >)n'" >)'4 ~)6' ~)˅' {n)'  )' )˅' ) $ȯ E)# ]&)}#ȯ G)_w# (_w#6p #(@e#  S'@e#7p '_w# V'_w# F%!.) %!  >%!btatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatctdtetftgthtitjtktltmtntotptqtrtstttutvtwtxtytzt{t|t}t~tttttttttttttttttttttt֍r v% f%  % %%_ %4C: 4%,C: %$= hc%,tttttttttttttttt֍r i%%  %% tttt֍r %%:&  %:& tttt֍r %(+%  %(+% tttt֍r %"  q &" tttt֍r %p#  I&p# tttt֍r [%( h&(6 &&(0 h&' %' I %'tttttttttttt֍r Y%ԑ+  '&ԑ+ tttt֍r %\*  )&\* tttt֍r : &" G&$  \&$ 1 K&Oe j`&,   &,tttttttttttt֍r (&  v& tttt֍r /&j$  }&j$ tttt֍r D&T]!  a&T]! tttt֍r c&)  &) tttt֍r }j& +  & + tttt֍r r&+  &+ tttt֍r ~&#  1&# tttt֍r &  +' tttt֍r &$  +'$ tttt֍r ''  h'' tttt֍r ! 'l+  m'l+ tttt֍r )'&  v'& tttt֍r .'!  {'! tttt֍r UA',;%  ',;% tttt֍r t'l"  'l" tttt֍r {'Dv'  Q'Dv' tttt֍r T|' < %z'&  '&  R'T '  B'tttttttttttt֍r {''  '' tttt֍r 'M% )(/&ȯ ?(5& )5&8 kT)x &q +)%- e,)(%y &)(% ]W)%  )%y )%  ((% U(# & (# & '"%.) '<%  O'<%ttttttttttttttttttttttuuuuuuuuu u u u֍r y'+  i8(+  u u uu֍r ['  S( uuuu֍r '/+  E/(/+ uuuu֍r '@@%  91(@@% uuuu֍r '  8( uuuu֍r (|!  Ea(|! uuuu֍r 7(u֍r kx(^"  (^" @u?u?uAu֍r ](`f'_ g(0~'  -(0~'_CuBuBuBuDuEu֍r ](`f'_ -(N'  g(N'_GuFuFuFuHuIu֍r (#  (# KuJuJuLu֍r ("  (" NuMuMuOu֍r (ܨ  q(ܨ QuPuPuRu֍r e(|5!  (|5! TuSuSuUu֍r e(!  (! WuVuVuXu֍r ("  (" ZuYuYu[u֍r (`f' (2}'  (2}' (`f' (O'  (O']u\u\u\u\u\u\u^u_u`uaubu֍r ('_ ('  ('_ducucucueufu֍r ('  I)' huguguiu֍r (0~'  G )0~' kujujulu֍r (G'  C )G' numumuou֍r )]"  QY)]" qupupuru֍r Q )X"  Y)X" tususuuu֍r a)+  g)+ wuvuvuxu6r(C'$<,r(C'$<,^̍L|u W(&  1(& }u}uu6{uW(& zuW(& ^̍Lu c|(O  c|(b uuu6uc|(O uc|(O ^̍Lu oS(&  @(& uuu6uoS(& uoS(& ^̍Lu c|( c|(.uuu6uc|(uc|(^̍Lu Y(} (֊uuu6uY(}uY(}^̍Lu m_(} R(֊uuu6um_(}um_(}^̍Lu '} ='֊uuu6u'}u'}^̍Lu '} '֊uuu6u'}u'}^̍Lu '&  '& uuu6u'& u'& ^̍Lu 'O  'b uuu6u'O u'O ^̍Lu '&  %z'& uuu6u'& u'& ^̍Lu ' '.uuu6u'u'^̍Lu ;<$} ;<$Wuuu6u;<$}u;<$}^̍Lu $$, $,uuu6u$$,u$$,^̍Lu ;<$۷ ;<$uuu6u;<$۷u;<$۷^̍Lu $, $,uuu6u$,u$,^̍Lu $۷ $uuu6u$۷u$۷^̍Lu Bv%, hc%,uuu6uBv%,uBv%,^̍Lu %۷ %uuu6u%۷u%۷^̍Lv M&, j`&,vvv6vM&,uM&,^̍Lv &,  &, v v v6v&,v&,^̍Lv ?6&۷ ?6&vvv6v?6&۷ v?6&۷^̍Lv '!q' !q'vvv6v'!q'v'!q'^̍Lv o!' o!t'vv v6vo!'vo!'^̍L$v Q!q' >!q'%v%v'v6#vQ!q'"vQ!q'^̍L+v o!*?' o!P,',v,v.v6*vo!*?')vo!*?'^̍L2v ?"  R" 3v3v5v61v?" 0v?" ^̍L9v "  1! :v:vv_&" ^̍LGv &+ &+HvHvJv6Fv&+Ev&+^̍LNv ɧ&, ɧ&),OvOvQv6Mvɧ&,Lvɧ&,^̍LUv &+ r&+VvVvXv6Tv&+Sv&+^̍L\v ɧ&+ ɧ&+]v]v_v6[vɧ&+Zvɧ&+^̍Lcv %(+ i8(+dvdvfv6bv%(+av%(+^̍Ljv q(, q(),kvkvmv6ivq(,hvq(,^̍Lqv S'+ y'+rvrvtv6pvS'+ovS'+^̍Lxv q(+ q(+yvyv{v6wvq(+vvq(+^̍Lv U'K, U'8,vvv6~vU'K,}vU'K,^̍Lv ^ " q "vvv6v^ "v^ "^̍Lv J " J d"vvv6vJ "vJ "^̍Lv 7 " &$ "vvv6v7 "v7 "^̍Lv J ڃ" J q"vvv6vJ ڃ"vJ ڃ"^̍Lv E"" +""vvv6vE""vE""^̍Lv m"Ե" m""vvv6vm"Ե"vm"Ե"^̍Lv !" !"vvv6v!"v!"^̍Lv m"$" m"J{"vvv6vm"$"vm"$"^̍Lv Q#! +##!vvv6vQ#!vQ#!^̍Lv y"! y"^!vvv6vy"!vy"!^̍Lv "! "!vvv6v"!v"!^̍Lv y"Է! y"!vvv6vy"Է!vy"Է!^̍Lv /'U& 'U&vvv6v/'U&v/'U&^̍Lv h'U& U'U&vvv6vh'U&vh'U&^̍Lv W|'$B& W|'J/&vvv6vW|'$B&vW|'$B&^̍Lv Z'l+ m'l+vvv6vZ'l+vZ'l+^̍Lv F'D+ F'+vvv6vF'D+vF'D+^̍Lv 2'l+ ! 'l+vvw6v2'l+v2'l+^̍Lw F'm+ F'Z+www6wF'm+wF'm+^̍L w " + ݦ" + w ww6 w" + w" +^̍Lw +"+ +"+www6w+"+w+"+^̍Lw Sl" + yY" +www6wSl" +wSl" +^̍L w +"4}+ +"Zj+!w!w#w6w+"4}+w+"4}+^̍L'w g*#h* A=#h*(w(w*w6&wg*#h*%wg*#h*^̍L.w #@* #*/w/w1w6-w#@*,w#@*^̍L5w #h* "h*6w6w8w64w#h*3w#h*^̍L!ԥ* >!*www6w>!ԥ*w>!ԥ*^̍Lw #+!* I!*www6w#+!*w#+!*^̍Lw >!$~* >!Jk*www6w>!$~*w>!$~*^̍Lw Za+ Za+www6w Za+w Za+^̍Lw 2u+ +www6w 2u+w 2u+^̍Lw Za+ % Za+www6w Za+w Za+^̍Lw M+ :+www6w M+w M+^̍Lw } & [ &www6w} &w} &^̍Lw i |& i V&www6wi |&wi |&^̍Lw U & B &www6wU &wU &^̍Lx i ̱& i &xxx6wi ̱&wi ̱&^̍Lx %:& %:&xx x6x%:&x%:&^̍Lx %|N& %Va&xxx6 x%|N& x%|N&^̍Lx %:& %%:&xxx6x%:&x%:&^̍Lx %&& %&xxx6x%&&x%&&^̍L#x $ # q/$ #$x$x&x6"x$ #!x$ #^̍L*x $l # $F3#+x+x-x6)x$l #(x$l #^̍L1x # # # #2x2x4x60x# #/x# #^̍L8x $" $"9x9x;x67x$"6x$"^̍L?x #x## ##@x@xBx6>x#x##=x#x##^̍LFx Kd## Kd#r#GxGxIx6ExKd##DxKd##^̍LMx sP## =##NxNxPx6LxsP##KxsP##^̍LTx Kd#v# Kd#d#UxUxWx6SxKd#v#RxKd#v#^̍L[x ?##" ##"\x\x^x6Zx?##"Yx?##"^̍Lbx g#7" g#vJ"cxcxex6axg#7"`xg#7"^̍Lix ##" ##"jxjxlx6hx##"gx##"^̍Lpx g#" g#!qxqxsx6oxg#"nxg#"^̍Lwx l % ~ %xxxxzx6vxl %uxl %^̍L~x 7X % 7X %xxx6}x7X %|x7X %^̍Lx _D % 1 %xxx6x_D %x_D %^̍Lx 7X ,% 7X R%xxx6x7X ,%x7X ,%^̍Lx z L$ ] L$xxx6xz L$xz L$^̍Lx f $$ f $xxx6xf $$xf $$^̍Lx R L$ ? L$xxx6xR L$xR L$^̍Lx f t$ f $xxx6xf t$xf t$^̍Lx 3 # #xxx6x3 #x3 #^̍Lx [k # [k #xxx6x[k #x[k #^̍Lx W # D #xxx6xW #xW #^̍Lx [k @# [k f#xxx6x[k @#x[k @#^̍Lx  ! !xxx6x !x !^̍Lx ? ! ? \!xxx6x? !x? !^̍Lx g ! !xxx6xg !xg !^̍Lx ? Ҵ! ? !xxx6x? Ҵ!x? Ҵ!^̍Lx >$_# mQ$_#xxx6x>$_#x>$_#^̍Lx *$r# *$#xxx6x*$r#x*$r#^̍Lx $_# $_#xxx6x$_#x$_#^̍Lx *$(K# *$N8#xxx6x*$(K#x*$(K#^̍Ly W#! 1#!yyy6yW#!yW#!^̍L y #! #! y y y6 y#!y#!^̍Ly #! w#!yyy6y#!y#!^̍Ly #! #6z!yyy6y#!y#!^̍Ly k ( E ( y y"y6yk (yk (^̍L&y |)( V<('y'y)y6%y |)($y |)(^̍L-y o ( \ (.y.y0y6,yo (+yo (^̍L4y ( '5y5y7y63y (2y (^̍L;y i#h& |#h&y6:yi#h&9yi#h&^̍LBy U#@& U#'CyCyEy6AyU#@&@yU#@&^̍LIy A#h& %/#h&JyJyLy6HyA#h&GyA#h&^̍LPy U#& U#&QyQySy6OyU#&NyU#&^̍LWy +j&j$ }&j$XyXyZy6Vy+j&j$Uy+j&j$^̍L^y SV&}$ SV&$_y_yay6]ySV&}$\ySV&}$^̍Ley {B&j$ /&j$fyfyhy6dy{B&j$cy{B&j$^̍Lly SV&(V$ SV&NC$mymyoy6kySV&(V$jySV&(V$^̍Lsy #%(+% %(+%tytyvy6ry#%(+%qy#%(+%^̍Lzy K%?% K%Q%{y{y}y6yyK%?%xyK%?%^̍Ly s%(+% %(+%yyy6ys%(+%ys%(+%^̍Ly K%P% K%v%yyy6yK%P%yK%P%^̍Ly o&p# I&p#yyy6yo&p#yo&p#^̍Ly %H# %"#yyy6y%H#y%H#^̍Ly %p# %p#yyy6y%p#y%p#^̍Ly %{# %h#yyy6y%{#y%{#^̍Ly &T]! a&T]!yyy6y&T]!y&T]!^̍Ly k&,q! k&!yyy6yk&,q!yk&,q!^̍Ly W&T]! D&T]!yyy6yW&T]!yW&T]!^̍Ly k&|I! k&6!yyy6yk&|I!yk&|I!^̍Ly W&# 1&#yyy6yW&#yW&#^̍Ly &# &#yyy6y&#y&#^̍Ly &# ~&#yyy6y&#y&#^̍Ly &@# &f#yyy6y&@#y&@#^̍Ly %" q &"yyy6y%"y%"^̍Ly %t" %N"yyy6y%t"y%t"^̍Ly %" %"yyy6y%"y%"^̍Ly %Ĵ" %"yyy6y%Ĵ"y%Ĵ"^̍Ly Q$L! d$L!zzz6yQ$L!yQ$L!^̍Lz =$$" =$!"zz z6z=$$"z=$$"^̍L z *$L! ?$L!zzz6 z*$L! z*$L!^̍Lz =$t! =$!zzz6z=$t!z=$t!^̍Lz $!! w,$!!zzz6z$!!z$!!^̍L"z $5! $H!#z#z%z6!z$5! z$5!^̍L)z #!! #!!*z*z,z6(z#!!'z#!!^̍L0z $! $6 1z1z3z6/z$!.z$!^̍L7z <"Zw  O"Zw 8z8z:z66z<"Zw 5z<"Zw ^̍L>z #)"2  #)" ?z?zAz6=z#)"2 #" >#ޥ"{{{6{>#"{>#"^̍L{ *#," #,"{{{6{*#,"{*#,"^̍L{ >#Tk" >#zX"{{{6{>#Tk"{>#Tk"^̍L{ !" !"{{{6{!"{!"^̍L{ !," !?"{{{6{ !,"{ !,"^̍L{ 1!" W!"{{|6{1!"{1!"^̍L| !8" !^!|||6| !8"| !8"^̍L | u#`! _#`! | ||6 |u#`! |u#`!^̍L| a#8" a#"|||6|a#8"|a#8"^̍L| M#`! :#`!|||6|M#`!|M#`!^̍L!| a#! a#!"|"|$|6 |a#!|a#!^̍L(| ?!nO" R!nO")|)|+|6'|?!nO"&|?!nO"^̍L/| +!Fc" +! v"0|0|2|6.|+!Fc"-|+!Fc"^̍L6| !nO" =!nO"7|7|9|65|!nO"4|!nO"^̍L=| +!;" +!(">|>|@|6<|+!;";|+!;"^̍LD| 3!/# F!/#E|E|G|6C|3!/#B|3!/#^̍LK| !C# !nV#L|L|N|6J|!C#I|!C#^̍LR| !/# ! /#S|S|U|6Q| !/#P| !/#^̍LY| !# ! #Z|Z|\|6X|!#W|!#^̍L`| 3G!B! Z!B!a|a|c|6_|3G!B!^|3G!B!^̍Lg| [3!! [3!!h|h|j|6f|[3!!e|[3!!^̍Ln| !B! !B!o|o|q|6m|!B!l|!B!^̍Lu| [3!jr! [3!_!v|v|x|6t|[3!jr!s|[3!jr!^̍L|| I!% e\!%}|}||6{|I!%z|I!%^̍L| 5!'% 5!:%|||6|5!'%|5!'%^̍L| !!% !%|||6|!!%|!!%^̍L| 5!D% 5!j$|||6|5!D%|5!D%^̍L| 6"-' " '|||6|6"-'|6"-'^̍L| $"& Ї"&|||6|$"&|$"&^̍L| p"|( m"|(|||6|p"|(|p"|(^̍L| \"T( \".(|||6|\"T(|\"T(^̍L| H"|( 6"|(|||6|H"|(|H"|(^̍L| \"( \"ʮ(|||6|\"(|\"(^̍L| l##' 0#q'|||6|l##'|l##'^̍L| Z# p' "b'|||6|Z# p'|Z# p'^̍L| "' "'|||6|"'|"'^̍L| G"' G"^'|||6|G"'|G"'^̍L| o"' o"'|||6|o"'|o"'^̍L| G"ԫ' G"'|||6|G"ԫ'|G"ԫ'^̍L| ) )|||6| )| )^̍L|  ')  :)|||6| ')| ')^̍L| G ) m )|||6|G )|G )^̍L}  &)  L(}}}6} &)| &)^̍L} v$( v$( } } }6}v$(}v$(^̍L} b$B' O$B'}}}6}b$B' }b$B'^̍L} v$j' v$'}}}6}v$j'}v$j'^̍L} d'& v'&}} }6} d'&} d'&^̍L$} 3P'' 3P'v'%}%}'}6#}3P''"}3P''^̍L+} [<'& )'&,},}.}6*}[<'&)}[<'&^̍L2} 3P'& 3P'&3}3}5}61}3P'&0}3P'&^̍L9} c_$) =r$):}:}<}68}c_$)7}c_$)^̍L@} K$) K$)A}A}C}6?}K$)>}K$)^̍LG} 7$) $$)H}H}J}6F}7$)E}7$)^̍LN} K$8) K$^)O}O}Q}6M}K$8)L}K$8)^̍LU} ") #)V}V}X}6T}")S}")^̍L\} /"ز) /")]}]}_}6[}/"ز)Z}/"ز)^̍Lc} W") }")d}d}f}6b}W")a}W")^̍Lj} /"() /"Nx)k}k}m}6i}/"()h}/"()^̍Lq} 4"6r' H"6r'r}r}t}6p}4"6r'o}4"6r'^̍Lx} !"' !"'y}y}{}6w}!"'v}!"'^̍L} ; "6r' c!6r'}}}6~}; "6r'}}; "6r'^̍L} !"^^' !"J'}}}6}!"^^'}!"^^'^̍L} \ ) n )}}}6} \ )} \ )^̍L} 3H `) 3H :)}}}6}3H `)}3H `)^̍L} [4 ) ! )}}}6}[4 )}[4 )^̍L} 3H ) 3H ֋)}}}6}3H )}3H )^̍L} & + & +}}}6}& +}& +^̍L} /&+ /&^1+}}}6}/&+}/&+^̍L} W}& + }j& +}}}6}W}& +}W}& +^̍L} /&* /&*}}}6}/&*}/&*^̍L} k(/+ E/(/+}}}6}k(/+}k(/+^̍L} (B+ (U+}}}6}(B+}(B+^̍L} '/+ '/+}}}6}'/+}'/+^̍L} ((+ (N+}}}6}((+}((+^̍L} &ԑ+ '&ԑ+}}}6}&ԑ+}&ԑ+^̍L} &+ &+}}}6} &+} &+^̍L} 3%ԑ+ Y%ԑ+}}}6}3%ԑ+}3%ԑ+^̍L} &}+ &"k+}}}6} &}+} &}+^̍L} T)+ g)+}}~6}T)+}T)+^̍L~ A)`+ A):+~~~6~A)`+~A)`+^̍L ~ ;-)+ a)+ ~ ~~6 ~;-)+ ~;-)+^̍L~ A)+ A)ֱ+~~~6~A)+~A)+^̍L~ '&) &)~~~6~'&)~'&)^̍L ~ O&) O&b)!~!~#~6~O&)~O&)^̍L'~ wv&) c&)(~(~*~6&~wv&)%~wv&)^̍L.~ O&إ) O&)/~/~1~6-~O&إ),~O&إ)^̍L5~ %) 3%)6~6~8~64~ %)3~ %)^̍L<~ %) %)=~=~?~6;~ %):~ %)^̍LC~ $) 5$)D~D~F~6B~$)A~$)^̍LJ~ Kd(# %w(#K~K~M~6I~Kd(#H~Kd(#^̍LQ~ sP(# sP(^$R~R~T~6P~sP(#O~sP(#^̍LX~ <(# )(#Y~Y~[~6W~<(#V~<(#^̍L_~ sP(# sP(#`~`~b~6^~sP(#]~sP(#^̍Lf~ kN(|! Ea(|!g~g~i~6e~kN(|!d~kN(|!^̍Lm~ :(T! :(. "n~n~p~6l~:(T!k~:(T!^̍Lt~ &(|! (|!u~u~w~6s~&(|!r~&(|!^̍L{~ :(! :(ʽ!|~|~~~6z~:(!y~:(!^̍L~ 'l" 'l"~~~6~ 'l"~ 'l"^̍L~ 3'D" 3'"~~~6~3'D"~3'D"^̍L~ ['l" t'l"~~~6~['l"~['l"^̍L~ 3'" 3'"~~~6~3'"~3'"^̍L~ F)X" Y)X"~~~6~F)X"~F)X"^̍L~ 3)0" 3) "~~~6~3)0"~3)0"^̍L~ +)X" Q )X"~~~6~+)X"~+)X"^̍L~ 3)" 3)"~~~6~3)"~3)"^̍L~ wF)]" QY)]"~~~6~wF)]"~wF)]"^̍L~ 2)lq" 2)F"~~~6~2)lq"~2)lq"^̍L~ )]" )]"~~~6~)]"~)]"^̍L~ 2)I" 2)6"~~~6~2)I"~2)I"^̍L~ D)% ]W)%~~~6~D)%~D)%^̍L~ 0)% 0)n%~~~6~0)%~0)%^̍L~ )% )%~~~6~)%~)%^̍L~ 0)% 0) %~~~6~0)%~0)%^̍L~ !(Rk( 3(Rk(~~~6~!(Rk(~!(Rk(^̍L~ C (*( C ((~~~6~C (*(~C (*(^̍L 3U'' h''6~3U''~3U''^̍L [A'( [A'~( 6[A'([A'(^̍L -'' ''6 -'' -''^̍L [A'' [A''6[A''[A''^̍L w'Dv' Q'Dv'6w'Dv'w'Dv'^̍L# '' ''$$&6"''!''^̍L* ǎ'Dv' {'Dv'++-6)ǎ'Dv'(ǎ'Dv'^̍L1 'lb' 'O'22460'lb'/'lb'^̍L8 ge),' ge)?'99;67ge),'6ge),'^̍L? Q)' >)'@@B6>Q)'=Q)'^̍LF )H( )"(GGI6E)H(D)H(^̍LM (p( (p(NNP6L(p(K(p(^̍LT )( )(UUW6S)(R)(^̍L[ () ))\\^6Z()Y()^̍Lb W() }()cce6aW()`W()^̍Li /() /(ڴ)jjl6h/()g/()^̍Lp c() ]v()qqs6oc()nc()^̍Lw O() O(j*xxz6vO()uO()^̍L~ ;() (()6};()|;()^̍L O() O()6O()O()^̍L )(% e,)(%6)(%)(%^̍L ((% ((%6((%((%^̍L )P% )v%6)P%)P%^̍L '$ +'$6 '$ '$^̍L 3'$ 3'~ %63'$3'$^̍L [&$ &$6[&$[&$^̍L 3'$ 3'$63'$3'$^̍L w$pp$ Q$pp$6w$pp$w$pp$^̍L #pp$ #pp$6#pp$#pp$^̍L #\$ #I$6#\$#\$^̍L N#pp$ a#pp$6N#pp$N#pp$^̍L :#H$ :#"$6:#H$:#H$^̍L '#pp$ 1#pp$6 '#pp$ '#pp$^̍L :#\$ :#I$6:#\$:#\$^̍L "f% i"f%6"f%"f%^̍L "`z% ":%6"`z%"`z%^̍L ߏ"f% }"f%6ߏ"f%ߏ"f%^̍L "R% "?%6"R%"R%^̍L iw$(  C$(    6 iw$( iw$( ^̍L c$  c$0 6c$ c$ ^̍L O$(  <$( 6O$( O$( ^̍L %  %%   "6% % ^̍L& $!  $^4 '')6% $! $ $! ^̍L- 1$  W$ ..06,1$ +1$ ^̍L4 %  % 55763% 2% ^̍L; 9%%  9%8 <<>6:9%% 99%% ^̍LB ay%  f% CCE6Aay% @ay% ^̍LI I&$  \&$ JJL6HI&$ GI&$ ^̍LP 5&&  5&9 QQS6O5&& N5&& ^̍LW !"&$  G&$ XXZ6V!"&$ U!"&$ ^̍L^ S(' -('__a6]S('\S('^̍Le ](' ]('ffh6d]('c]('^̍Ll gz(' g('mmo6kgz('jgz('^̍Ls ](Ʋ' ]('ttv6r](Ʋ'q](Ʋ'^̍Lz ۿ(' ('{{}6yۿ('xۿ('^̍L (' ('6('('^̍L (' ('6('('^̍L (Ʋ' ('6(Ʋ'(Ʋ'^̍L S(0~' -(0~'6S(0~'S(0~'^̍L ](&' ]('6](&'](&'^̍L gz(0~' g(0~'6gz(0~'gz(0~'^̍L ](:y' ](`f'6](:y'](:y'^̍L ۿ(2}' (2}'6ۿ(2}'ۿ(2}'^̍L ((' ('6(('(('^̍L (2}' (2}'À6(2}'(2}'^̍Lǀ S(Z' -(Z'ȀȀʀ6ƀS(Z'ŀS(Z'^̍L΀ gz(Z' g(Z'ππр6̀gz(Z'̀gz(Z'^̍LՀ ](d' ]('րր؀6Ԁ](d'Ӏ](d'^̍L܀ S(N' -(N'݀݀߀6ۀS(N'ڀS(N'^̍L ](S' ](`f'6](S'](S'^̍L gz(N' g(N'6gz(N'gz(N'^̍L ](I' ](6'6](I'](I'^̍L ۿ(\' (\'6ۿ(\'ۿ(\'^̍L (\' (\'6(\'(\'^̍L (f' (' 6(f'(f'^̍L ۿ(O' (O'6 ۿ(O' ۿ(O'^̍L (O' (O'6(O'(O'^̍L (J' (7'6(J'(J'^̍L" Q(2}' d(2}'##%6!Q(2}' Q(2}'^̍L) L((' L('**,6(L((''L(('^̍L0 G(2}' 4(2}'1136/G(2}'.G(2}'^̍L7 L( N(F' a(F'??A6=N(F'<N(F'^̍LE I(K' I(p^'FFH6DI(K'CI(K'^̍LL D(F' 1(F'MMO6KD(F'JD(F'^̍LS I(A' I(.'TTV6RI(A'QI(A'^̍LZ P(' c('[[]6YP('XP('^̍La K(' K('bbd6`K('_K('^̍Lh F(' 3('iik6gF('fF('^̍Lo K(Ʋ' K('ppr6nK(Ʋ'mK(Ʋ'^̍Lv O(H' b(H'wwy6uO(H'tO(H'^̍L} E(H' 2(H'~~6|E(H'{E(H'^̍L J(R' J(x'6J(R'J(R'^̍L o(L' I)L'6o(L'o(L'^̍L (L' (L'6(L'(L'^̍L y(V' y(|'6y(V'y(V'^̍L o(' I)'6o('o('^̍L y(' y('6y('y('^̍L (' ('6('('^̍L y(ij' y('6y(ij'y(ij'^̍L m(0~' G )0~'6m(0~'m(0~'^̍LÁ w(&' w('āāƁ6w(&'w(&'^̍Lʁ (0~' (0~'ˁˁ́6Ɂ(0~'ȁ(0~'^̍Lс w(:y' w(`f'ҁҁԁ6Ёw(:y'ρw(:y'^̍L؁ i(G' C )G'ففہ6ׁi(G'ցi(G'^̍L߁ s(L' s(n_'6ށs(L'݁s(L'^̍L }(G' (G'6}(G'}(G'^̍L s(B' s(/'6s(B's(B'^̍L 1(^" (^"61(^"1(^"^̍L ;(T" ;(.#6;(T";(T"^̍L E(^" kx(^"6E(^"E(^"^̍L ;(h" ;("   6;(h";(h"^̍L (# (#6(#(#^̍L (# (-#6(#(#^̍L (# (#!6(#(#^̍L% (# (B"&&(6$(##(#^̍L, (" ("--/6+("*("^̍L3 (" (x"44662("1("^̍L: (" (";;=69("8("^̍LA (" (س"BBD6@("?("^̍LH yq(" S("IIK6Gyq("Fyq("^̍LO l(" l(x"PPR6Nl("Ml("^̍LV g(" T("WWY6Ug("Tg("^̍L] l(" l(س"^^`6\l("[l("^̍Ld yq(# S(#eeg6cyq(#byq(#^̍Lk l(# l(-#lln6jl(#il(#^̍Lr g(# T(#ssu6qg(#pg(#^̍Ly l(# l(B"zz|6xl(#wl(#^̍L .0'K, K, ֍ #(%  M$(% @??A֍ #$  W$$ CBBD֍ #!!  {*$!! FEEG֍ # #  u-$ # IHHJ֍ $_#  qO$_# LKKM֍ ;$L!  b$L! ONNP֍ &$)  Ap$) RQQS֍ ($H&  mq$H& UTTV֍ >C$n >$(  G$( q $MT ܪ$,C: _$$= $,XWWWWWWWYZ[\]^֍ L$^*  _$^* `__a֍ Q$B'  5$B' cbbd֍ $!  $! feeg֍ c$4*  $4* ihhj֍ $!  G%! lkkm֍ $ S$  #% 8 M%6 S%,C: 9%$= $,Honnnnnnnpqrstu֍ 1$)  1%) wvvx֍ )%!  J%! zyy{֍ *%*  ?r%* }||~֍ }@%!  %! ֍ zx%% h%  % I%Qk %4C: 4%,C: %$= hc%,J֍ e%%  %% ֍ ;%'  %' ֍ !%:&  %:& ֍ %(+%  %(+% ֍ %"  u&" ֍ %p#  M&p# ֍ U%ԑ+  %&ԑ+ ֍ %Y'  %&Y' ֍ %\*  '&\* ֍ &"&> C&$  Z&$  J&g, j`&,   &,`֍ *&  t& ֍ 1&j$  {&j$ ֍ F&T]!  e&T]! ֍ d&&(  &&( ֍ e&)  &) ֍ yl& +  & + ֍ 3u&+  _&+ ֍ ɀ&#  5&# Ãă֍ }&  )' ƃŃŃǃ֍ }&$  )'$ Ƀȃȃʃ֍ c'^*  ^'^* ̃˃˃̓֍ ''  f'' σ΃΃Ѓ֍ "'l+  k'l+ ҃ууӃ֍ }+'&  t'& Ճԃԃփ֍ 0'!  y'! ؃׃׃ك֍ QC',;%  ',;% ۃڃڃ܃֍ W'U&  'U& ރ݃݃߃֍ }v'l"  'l" ֍ }'Dv'  U'Dv' ֍ '*W R'1*  3'1*1 Q')*V K'*  ۀ'*1֍ K' c }'&  '& # ' S '  D'֍ K'<%  '<% ֍ w''  '' ֍ '(  (( ֍ '+  6(+ ֍ O'@e#  !(@e# ֍ '  ;P( ֍ '/+  I-(/+ ֍ '@@%  =/(@@%     ֍ 'Rk(  1(Rk(    ֍ '  6( ֍ (|!  I_(|! ֍ 3()  cs(>)  ֍ 1(F'  a(F' "!!#֍ 2(H'  b(H' %$$&֍ 3('  c(' ('')֍ 4(2}'  d(2}' +**,֍ ?(&  M(& .--/֍ UD(&  q(& 1002֍ D(0d%  )(0d% 4335֍ T("  S(" 7668֍ T(#  S(# :99;֍ g('  -(' =<<>֍ g(Z'  -(Z' @??A֍ kx(^"  (^" CBBD֍ ](`f'_ g(0~'  -(0~'_FEEEGH֍ ](`f'_ -(N'  g(N'_JIIIKL֍ (#  (# NMMO֍ ("  (" QPPR֍ (ܨ  u(ܨ TSSU֍ a(|5!  (|5! WVVX֍ a(!  (! ZYY[֍ (Lj&  (Lj& ]\\^֍ ("  (" `__a֍ (`f' (2}'  (2}' (`f' (O'  (O'cbbbbbbdefgh֍ ('_ (\'  (\'_jiiikl֍ ('_ ('  ('_nmmmop֍ (#  Q)# rqqs֍ () (0*  (0*ǒ (h), ))  y()!uttttttvwxyz֍ ('  I)' |{{}֍ (L'  I)L' ~~֍ (0~'  G )0~' ֍ (G'  C )G' ֍ 2 )J&/: )x &  oR)x &{ ))6%> i*)(%{ z!)(%  aU)%  )%| )%  ((%b֍ )]"  UW)]" ֍ M)X"  W)X" ֍ /)[(  c)[( ֍ ])+  e)+ ֍ B$)r(% c)(" $)Ծ(* (p('֍ g=)'& W )&3 A)D'/5 @)'  )' S)&j2 T)&T/ S)-& )&  <)&U/֍ wp)'  )' ֍ )(  {)( 6.0'K,~.0'K,^̍L (&  q(& 6(& (& ^̍L c|(0L  c|( _ 6c|(0L c|(0L ^̍Lń /W(&  UD(& ƄƄȄ6Ą/W(& Ä/W(& ^̍L̄ c|(  c|(̈́̈́τ6˄c|( ʄc|( ^̍Lӄ (z (/ԄԄք6҄(zф(z^̍Lڄ b(z T(/ۄۄ݄6لb(z؄b(z^̍L B'z '/6B'z߄B'z^̍L 'z P'/6'z'z^̍L ''&  '& 6''& ''& ^̍L '0L  ' _ 6'0L '0L ^̍L '&  }'& 6'& '& ^̍L '  '6' ' ^̍L ;<$} ;<$W  6 ;<$} ;<$}^̍L $$, $,6$$,$$,^̍L ;<$۷ ;<$6;<$۷;<$۷^̍L $, $,!!#6$,$,^̍L' $۷ $((*6&$۷%$۷^̍L. Bv%, hc%,//16-Bv%,,Bv%,^̍L5 %۷ %66864%۷3%۷^̍L< M&, j`&,==?6;M&,:M&,^̍LC &,  &,DDF6B&,A&,^̍LJ ?6&۷ ?6&KKM6I?6&۷H?6&۷^̍LQ !q' e!q'RRT6P!q'O!q'^̍LX o!' o!ح'YY[6Wo!'Vo!'^̍L_ S[!q' yH!q'``b6^S[!q']S[!q'^̍Lf o!H' o!5'ggi6eo!H'do!H'^̍Lm K>"  %Q" nnp6lK>" kK>" ^̍Lt s"  ! uuw6ss" rs" ^̍L{ _&"  _&"6 ||~6z_&" y_&" ^̍L &+ _&+6&+&+^̍L ɧ&n, ɧ&H',6ɧ&n,ɧ&n,^̍L &+ 3u&+6 &+ &+^̍L ɧ&+ ɧ&+6ɧ&+ɧ&+^̍L -#(+ 6(+6-#(+-#(+^̍L q(n, q(H',6q(n,q(n,^̍L '+ '+6'+'+^̍L q(+ q(+6q(+q(+^̍L ,?'YW, 1'J,6,?'YW,,?'YW,^̍L l'YW, by'J,……ą6l'YW,l'YW,^̍Lȅ \ " o "ɅɅ˅6Dž\ "ƅ\ "^̍Lυ J " J h"ЅЅ҅6΅J "ͅJ "^̍Lօ 8 " "& "ׅׅم6Յ8 "ԅ8 "^̍L݅ J օ" J r"ޅޅ6܅J օ"ۅJ օ"^̍L I"" #)""6I""I""^̍L m"س" m""6m"س"m"س"^̍L !" !"6!"!"^̍L m" " m"F}"6m" "m" "^̍L U#! /!#!6U#!U#!^̍L y"! y"b! 6y"!y"!^̍L "! "!6 "! "!^̍L y"й! y"!6y"й!y"й!^̍L 3'U& 'U&63'U&3'U&^̍L# W|'g& W|'z&$$&6"W|'g&!W|'g&^̍L* {j'U& W'U&++-6){j'U&({j'U&^̍L1 W|' D& W|'F1&22460W|' D&/W|' D&^̍L8 X'l+ k'l+99;67X'l+6X'l+^̍L? F'H+ F'"+@@B6>F'H+=F'H+^̍LF 4'l+ "'l+GGI6E4'l+D4'l+^̍LM F'o+ F'\+NNP6LF'o+KF'o+^̍LT " + " +UUW6S" +R" +^̍L[ +"+ +"µ+\\^6Z+"+Y+"+^̍Lb On" + u[" +cce6aOn" +`On" +^̍Li +"0+ +"Vl+jjl6h+"0+g+"0+^̍Lp k(#h* E;#h*qqs6ok(#h*nk(#h*^̍Lw #D* #*xxz6v#D*u#D*^̍L~ #h* "h*6}#h*|#h*^̍L #~* #k*6#~*#~*^̍L 7!zU) !zU)67!zU)7!zU)^̍L [!Vg) [!0z)6[!Vg)[!Vg)^̍L |!zU) i!zU)6|!zU)|!zU)^̍L [!C) [!0)6[!C)[!C)^̍L ^$H& mq$H&6^$H&^$H&^̍L L$$& L$&6L$$&L$$&^̍L :$H& ($H&6:$H&:$H&^̍L L$l& L$&6L$l&L$l&^̍LĆ ;#( N#(ņņdž6Æ;#(†;#(^̍Lˆ *#( *#^(̆̆Ά6ʆ*#(Ɇ*#(^̍L҆ ;#( a#(ӆӆՆ6ц;#(І;#(^̍Lن *#w( *#d(چچ܆6؆*#w(׆*#w(^̍L S"(( -"((6߆S"((ކS"((^̍L w":( w"~M(6w":(w":(^̍L "(( x"((6"(("((^̍L w"( w"(6w"(w"(^̍L P!* c!*6P!*P!*^̍L >!أ* >!*6>!أ*>!أ*^̍L -!* E!*   6 -!*-!*^̍L >! * >!Fm*6>! *>! *^̍L Za+ Za+6 Za+ Za+^̍L 6s+ +  "6 6s+ 6s+^̍L& Za+ ! Za+'')6% Za+$ Za+^̍L- ~O+ <+..06, ~O++ ~O+^̍L4 { & _ &55763{ &2{ &^̍L; i & i Z&<<>6:i &9i &^̍LB W & D &CCE6AW &@W &^̍LI i ȳ& i &JJL6Hi ȳ&Gi ȳ&^̍LP %:& %:&QQS6O%:&N%:&^̍LW %L& %Z_&XXZ6V%L&U%L&^̍L^ %:& !%:&__a6]%:&\%:&^̍Le %(& %&ffh6d%(&c%(&^̍Ll $ # u-$ #mmo6k$ #j$ #^̍Ls $p# $J1#ttv6r$p#q$p#^̍Lz # # # #{{}6y# #x# #^̍L $" $"6$"$"^̍L 'v## ##6'v##'v##^̍L Kd## Kd#v#6Kd##Kd##^̍L oR## ?##6oR##oR##^̍L Kd#x# Kd# f#6Kd#x#Kd#x#^̍L C##" ##"6C##"C##"^̍L g#5" g#zH"6g#5"g#5"^̍L ##" ##"6##"##"^̍L g#" g#!6g#"g#"^̍L j % | %Ç6j %j %^̍LLJ 7X % 7X %ȇȇʇ6Ƈ7X %Ň7X %^̍L· [F % 3 %χχч6͇[F %̇[F %^̍LՇ 7X (% 7X N%ևև؇6ԇ7X (%Ӈ7X (%^̍L܇ x L$ a L$݇݇߇6ۇx L$ڇx L$^̍L f ($ f $6f ($f ($^̍L T L$ A L$6T L$T L$^̍L f p$ f $6f p$f p$^̍L 7} #  #67} #7} #^̍L [k # [k #6[k #[k #^̍L Y # F # 6Y #Y #^̍L [k <# [k b#6 [k <# [k <#^̍L  ! !6 ! !^̍L ? ! ? `!6? !? !^̍L" c ! !##%6!c ! c !^̍L) ? ζ! ? !**,6(? ζ!'? ζ!^̍L0 <$_# qO$_#1136/<$_#.<$_#^̍L7 *$p# *$#88:66*$p#5*$p#^̍L> $_# $_#??A6=$_#<$_#^̍LE *$$M# *$J:#FFH6D*$$M#C*$$M#^̍LL [#! 5#!MMO6K[#!J[#!^̍LS #IJ! #!TTV6R#IJ!Q#IJ!^̍LZ #! y#![[]6Y#!X#!^̍La # ! #2|!bbd6`# !_# !^̍Lh o ( I (iik6go (fo (^̍Lo '( Z:(ppr6n '(m '(^̍Lv q ( ^ (wwy6uq (tq (^̍L} ( '~~6| ({ (^̍L g#h& z#h&6g#h&g#h&^̍L U#D& U#&6U#D&U#D&^̍L C#h& !1#h&6C#h&C#h&^̍L U#& U#&6U#&U#&^̍L /h&j$ {&j$6/h&j$/h&j$^̍L SV&{$ SV&$6SV&{$SV&{$^̍L wD&j$ 1&j$6wD&j$wD&j$^̍L SV&$X$ SV&JE$6SV&$X$SV&$X$^̍L '%(+% %(+%6'%(+%'%(+%^̍LÈ K%=% K%O%ĈĈƈ6ˆK%=%K%=%^̍Lʈ o%(+% %(+%ˈˈ͈6Ɉo%(+%Ȉo%(+%^̍Lш K%L% K%r%҈҈Ԉ6ЈK%L%ψK%L%^̍L؈ s&p# M&p#ووۈ6׈s&p#ֈs&p#^̍L߈ %L# %&#6ވ%L#݈%L#^̍L %p# %p#6%p#%p#^̍L %}# %j#6%}#%}#^̍L }&T]! e&T]!6}&T]!}&T]!^̍L k&0o! k& !6k&0o!k&0o!^̍L Y&T]! F&T]!6Y&T]!Y&T]!^̍L k&xK! k&8!   6k&xK!k&xK!^̍L [&# 5&#6[&#[&#^̍L &# &#6&#&#^̍L &# ɀ&#!6&#&#^̍L% &<# &b#&&(6$&<##&<#^̍L, %" u&"--/6+%"*%"^̍L3 %x" %R"44662%x"1%x"^̍L: %" %";;=69%"8%"^̍LA %" %"BBD6@%"?%"^̍LH O$L! b$L!IIK6GO$L!FO$L!^̍LO =$( " =$ "PPR6N=$( "M=$( "^̍LV ,$L! ;$L!WWY6U,$L!T,$L!^̍L] =$p! =$!^^`6\=$p![=$p!^̍Ld $!! {*$!!eeg6c$!!b$!!^̍Lk $3! $F!lln6j$3!i$3!^̍Lr #!! #!!ssu6q#!!p#!!^̍Ly $ ! $2 zz|6x$ !w$ !^̍L :"Zw  M"Zw 6:"Zw ~:"Zw ^̍L #)"6  #)" 6#)"6 #)"6 ^̍L G"Zw  m"Zw 6G"Zw G"Zw ^̍L #)"~e  #)"R 6#)"~e #)"~e ^̍L Wa!$ 1t!$6Wa!$Wa!$^̍L {O!$ {O!'$6{O!${O!$^̍L =!$ *!$6=!$=!$^̍L {O!4# {O!Z#6{O!4#{O!4#^̍L %% %%6%%%%^̍L %|% %V%‰6%|%%|%^̍LƉ ?%% e%%ljljɉ6ʼn?%%ĉ?%%^̍L͉ %ķ% %%ΉΉЉ6̉%ķ%ˉ%ķ%^̍Lԉ y',;% ',;%ՉՉ׉6Ӊy',;%҉y',;%^̍Lۉ h'M% h'_%܉܉މ6ډh'M%ىh'M%^̍L +V',;% QC',;%6+V',;%+V',;%^̍L h'P)% h'v%6h'P)%h'P)%^̍L O{(0d% )(0d%6O{(0d%O{(0d%^̍L si( v% si(%6si( v%si( v%^̍L W(0d% D(0d%6W(0d%W(0d%^̍L si(TR% si(z?%6si(TR%si(TR%^̍L c(@@% =/(@@%  6 c(@@% c(@@%^̍L (R% (d%6 (R% (R%^̍L '@@% '@@%6'@@%'@@%^̍L! (d.% (%""$6  (d.% (d.%^̍L( w)# Q)#))+6'w)#&w)#^̍L/ (# (f#0026.(#-(#^̍L6 (# (#77965(#4(#^̍L= (Ե# (#>>@6<(Ե#;(Ե#^̍LD (! (!EEG6C(!B(!^̍LK (! (!LLN6J(!I(!^̍LR ;(! a(!SSU6Q;(!P;(!^̍LY (@! (f!ZZ\6X(@!W(@!^̍L` (|5! (|5!aac6_(|5!^(|5!^̍Lg (XG! (2Z!hhj6f(XG!e(XG!^̍Ln ;(|5! a(|5!ooq6m;(|5!l;(|5!^̍Lu (#! (!vvx6t(#!s(#!^̍L| $(  6( }}6{$( z$( ^̍L 9(p  9(J 69(p 9(p ^̍L ](  ' 6]( ]( ^̍L 9(  9(޴ 69( 9( ^̍L (ܨ  u(ܨ 6(ܨ (ܨ ^̍L (  ( 6( ( ^̍L (ܨ  (ܨ 6(ܨ (ܨ ^̍L (  (& 6( ( ^̍L '  )' 6' ' ^̍L 3'ؤ  3' 63'ؤ 3'ؤ ^̍LŠ W&  }& ÊÊŊ6W& W& ^̍LɊ 3'  3'Fn ʊʊ̊6Ȋ3' NJ3' ^̍LЊ #g'! y'!ъъӊ6ϊ#g'!Ί#g'!^̍L׊ GU'! GU'!؊؊ڊ6֊GU'!ՊGU'!^̍Lފ kC'! 0'!ߊߊ6݊kC'!܊kC'!^̍L GU'o! GU'*\!6GU'o!GU'o!^̍L -a&  t& 6-a& -a& ^̍L QO&x  QO&R!6QO&x QO&x ^̍L u=&  *& 6u=& u=& ^̍L QO&  QO& 6QO& QO& ^̍L z' '   6z'z'^̍L h'l  h'F 6h'l  h'l ^̍L V' D'6V'V'^̍L h' h' 6h'h'^̍L$ P#," c#,"%%'6#P#,""P#,"^̍L+ >#" >#",,.6*>#")>#"^̍L2 ,#," #,"33561,#,"0,#,"^̍L9 >#Pm" >#vZ"::<68>#Pm"7>#Pm"^̍L@ !" !"AAC6?!">!"^̍LG !*" !="HHJ6F !*"E !*"^̍LN -!" S!"OOQ6M-!"L-!"^̍LU !4" !Z!VVX6T !4"S !4"^̍L\ s#`! c#`!]]_6[s#`!Zs#`!^̍Lc a#<" a#"ddf6ba#<"aa#<"^̍Lj O#`! <#`!kkm6iO#`!hO#`!^̍Lq a#! a#!rrt6pa#!oa#!^̍Lx =!nO" P!nO"yy{6w=!nO"v=!nO"^̍L +!Ja" +!$t"6~+!Ja"}+!Ja"^̍L !nO" 9!nO"6!nO"!nO"^̍L +!=" +!*"6+!="+!="^̍L 1!/# D!/#61!/#1!/#^̍L !A# !rT#6!A#!A#^̍L !/#  /#6 !/# !/#^̍L !# ! #6!#!#^̍L 7E!B! X!B!67E!B!7E!B!^̍L [3!! [3!!6[3!![3!!^̍L !!B! !B!6!!B!!!B!^̍Lŋ [3!ft! [3!a!ƋƋȋ6ċ[3!ft!Ë[3!ft!^̍L̋ G!% iZ!%͋͋ϋ6ˋG!%ʋG!%^̍LӋ 5!%% 5!8%ԋԋ֋6ҋ5!%%ы5!%%^̍Lڋ #!% !%ۋۋ݋6ً#!%؋#!%^̍L 5!@% 5!f$65!@%ߋ5!@%^̍L "$' "$'6 "$' "$'^̍L -"' -")'6-"'-"'^̍L Q"$' w~"$'6Q"$'Q"$'^̍L -"H& -"n&6-"H&-"H&^̍L n"|( q"|(6n"|(n"|(^̍L \"X( \"2(  6 \"X( \"X(^̍L J"|( 8"|(6J"|(J"|(^̍L \"( \"ư(6\"(\"(^̍L ?'#~' :#~'!!#6?'#~'?'#~'^̍L' c#' c#ʢ'((*6&c#'%c#'^̍L. #~' "~'//16-#~',#~'^̍L5 c#8l' c#^Y'66864c#8l'3c#8l'^̍L< #"' "'==?6;#"':#"'^̍LC G"' G"b'DDF6BG"'AG"'^̍LJ k"' q"'KKM6Ik"'Hk"'^̍LQ G"Э' G"'RRT6PG"Э'OG"Э'^̍LX ) )YY[6W )V )^̍L_  %)  8)``b6^ %)] %)^̍Lf C ) i )ggi6eC )dC )^̍Lm  ")  H(nnp6l ")k ")^̍Lt [$B' 5$B'uuw6s[$B'r[$B'^̍L{ v$( v$(||~6zv$(yv$(^̍L d$B' Q$B'6d$B'd$B'^̍L v$f' v$'6v$f'v$f'^̍L b'& t'&6b'&b'&^̍L 3P'& 3P'z'63P'&3P'&^̍L W>'& }+'&6W>'&W>'&^̍L 3P'& 3P'&63P'&3P'&^̍L g]$) Ap$)6g]$)g]$)^̍L K$) K$)6K$)K$)^̍L 9$) &$)69$)9$)^̍L K$4) K$Z)ŒŒČ6K$4)K$4)^̍LȌ ") ")ɌɌˌ6nj ")ƌ ")^̍Lό /"ܰ) /")ЌЌҌ6Ό/"ܰ)͌/"ܰ)^̍L֌ S") y")׌׌ٌ6ՌS")ԌS")^̍L݌ /"$) /"Jz)ތތ6܌/"$)ی/"$)^̍L 2"6r' E"6r'62"6r'2"6r'^̍L !"' !"'6!"'!"'^̍L 7"6r' ]!6r'67"6r'7"6r'^̍L !"Z`' !"M'6!"Z`'!"Z`'^̍L Z ) l )6Z )Z )^̍L 3H d) 3H >) 63H d)3H d)^̍L W6 ) }# )6 W6 ) W6 )^̍L 3H ) 3H ҍ)63H )3H )^̍L & + & +6 & + & +^̍L# /&+ /&b/+$$&6"/&+!/&+^̍L* S& + yl& +++-6)S& +(S& +^̍L1 /&* /&*22460/&*//&*^̍L8 o(/+ I-(/+99;67o(/+6o(/+^̍L? (@+ (S+@@B6>(@+=(@+^̍LF '/+ '/+GGI6E'/+D'/+^̍LM ($+ (J +NNP6L($+K($+^̍LT &ԑ+ %&ԑ+UUW6S&ԑ+R&ԑ+^̍L[ &+ &+\\^6Z &+Y &+^̍Lb /%ԑ+ U%ԑ+cce6a/%ԑ+`/%ԑ+^̍Li &+ &m+jjl6h &+g &+^̍Lp R)+ e)+qqs6oR)+nR)+^̍Lw A)d+ A)>+xxz6vA)d+uA)d+^̍L~ 7/)+ ])+6}7/)+|7/)+^̍L A)+ A)ҳ+6A)+A)+^̍L +&) &)6+&)+&)^̍L O&) O&f)6O&)O&)^̍L sx&) e&)6sx&)sx&)^̍L O&ԧ) O&)6O&ԧ)O&ԧ)^̍L %) 1%)6%)%)^̍L %) %)6 %) %)^̍L $) 1$)6 $) $)^̍L %@) %f)6 %@) %@)^̍Lč Ob(# )u(#ōōǍ6ÍOb(#Ob(#^̍Lˍ sP(# sP(b$̍̍΍6ʍsP(#ɍsP(#^̍Lҍ >(# +(#ӍӍՍ6э>(#Ѝ>(#^̍Lٍ sP(# sP(#ڍڍ܍6؍sP(#׍sP(#^̍L oL(|! I_(|!6ߍoL(|!ލoL(|!^̍L :(X! :(2 "6:(X!:(X!^̍L ((|! (|!6((|!((|!^̍L :(! :(ƿ!6:(!:(!^̍L 'l" 'l"6'l"'l"^̍L 3'H" 3'""63'H"3'H"^̍L W'l" }v'l"   6 W'l"W'l"^̍L 3'" 3'"63'"3'"^̍L D)X" W)X"6D)X"D)X"^̍L 3)4" 3)"  "63)4"3)4"^̍L& '!)X" M)X"'')6%'!)X"$'!)X"^̍L- 3)|" 3)"..06,3)|"+3)|"^̍L4 {D)]" UW)]"55763{D)]"2{D)]"^̍L; 2)po" 2)J"<<>6:2)po"92)po"^̍LB )]" )]"CCE6A )]"@ )]"^̍LI 2)K" 2)8"JJL6H2)K"G2)K"^̍LP B)% aU)%QQS6OB)%NB)%^̍LW 0)% 0)r%XXZ6V0)%U0)%^̍L^ )% )%__a6])%\)%^̍Le 0)% 0)%ffh6d0)%c0)%^̍Ll (Rk( 1(Rk(mmo6k(Rk(j(Rk(^̍Ls C (.}( C ((ttv6rC (.}(qC (.}(^̍Lz g'Rk( 'Rk({{}6yg'Rk(xg'Rk(^̍L C (vY( C (F(6C (vY(C (vY(^̍L 7S'' f''67S''7S''^̍L [A'' [A'(6[A''[A''^̍L /'' ''6/''/''^̍L [A'' [A''6[A''[A''^̍L {'Dv' U'Dv'6{'Dv'{'Dv'^̍L ' ' ''6' '' '^̍L Ð'Dv' }'Dv'6Ð'Dv'Ð'Dv'^̍L 'hd' 'Q'6'hd''hd'^̍L Cw)' )'Î6Cw)'Cw)'^̍Lǎ ge)*' ge)='ȎȎʎ6Ǝge)*'Ŏge)*'^̍LΎ S)' @)'ώώю6͎S)'̎S)'^̍LՎ ge) ' ge)2&֎֎؎6Ԏge) 'ӎge) '^̍L܎ )L( )&(ݎݎߎ6ێ)L(ڎ)L(^̍L (p( (p(6(p((p(^̍L )( )(6)()(^̍L () ))6 () ()^̍L S() y()6S()S()^̍L /() /(ֶ)6/()/()^̍L a() at() 6a()a()^̍L O() O(n*6 O() O()^̍L =() *()6=()=()^̍L O() O()6O()O()^̍L" )(% i*)(%##%6!)(% )(%^̍L) )& )&**,6()&')&^̍L0 ((% ((%1136/((%.((%^̍L7 )L% )r%88:66)L%5)L%^̍L> '$ )'$??A6='$<'$^̍LE 3'$ 3' %FFH6D3'$C3'$^̍LL W&$ }&$MMO6KW&$JW&$^̍LS 3'$ 3'$TTV6R3'$Q3'$^̍LZ {#pp$ U$pp$[[]6Y{#pp$X{#pp$^̍La #L$ #&$bbd6`#L$_#L$^̍Lh #pp$ #pp$iik6g#pp$f#pp$^̍Lo #^$ #K$ppr6n#^$m#^$^̍Lv L#pp$ _#pp$wwy6uL#pp$tL#pp$^̍L} :#L$ :#&$~~6|:#L${:#L$^̍L )#pp$ -#pp$6)#pp$)#pp$^̍L :#^$ :#K$6:#^$:#^$^̍L "f% m"f%6"f%"f%^̍L "dx% ">%6"dx%"dx%^̍L ۑ"f% "f%6ۑ"f%ۑ"f%^̍L "T% "A%6"T%"T%^̍L mu$(  G$( 6mu$( mu$( ^̍L c$  c$. 6c$ c$ ^̍L Q$(  >$( 6Q$( Q$( ^̍LÏ %  #% ďďƏ6% % ^̍Lʏ $  $b2 ˏˏ͏6ɏ $ ȏ $ ^̍Lя -$  S$ ҏҏԏ6Џ-$ Ϗ-$ ^̍L؏ %  % ُُۏ6׏% ֏% ^̍Lߏ 9%#  9%6 6ޏ9%# ݏ9%# ^̍L ]{%  h% 6]{% ]{% ^̍L G&$  Z&$ 6G&$ G&$ ^̍L 5&%  5&7 65&% 5&% ^̍L $&$  C&$ 6$&$ $&$ ^̍L S(' -('6S('S('^̍L ](' ]('   6](']('^̍L gz(' g('6gz('gz('^̍L ](Ʋ' ]('6](Ʋ'](Ʋ'^̍L ۿ(' ('!6ۿ('ۿ('^̍L% (' ('&&(6$('#('^̍L, (' ('--/6+('*('^̍L3 (Ʋ' ('44662(Ʋ'1(Ʋ'^̍L: S(0~' -(0~';;=69S(0~'8S(0~'^̍LA ](&' ]('BBD6@](&'?](&'^̍LH gz(0~' g(0~'IIK6Ggz(0~'Fgz(0~'^̍LO ](:y' ](`f'PPR6N](:y'M](:y'^̍LV ۿ(2}' (2}'WWY6Uۿ(2}'Tۿ(2}'^̍L] ((' ('^^`6\(('[(('^̍Ld (2}' (2}'eeg6c(2}'b(2}'^̍Lk S(Z' -(Z'lln6jS(Z'iS(Z'^̍Lr ](P' ](*(ssu6q](P'p](P'^̍Ly gz(Z' g(Z'zz|6xgz(Z'wgz(Z'^̍L ](d' ]('6](d'~](d'^̍L S(N' -(N'6S(N'S(N'^̍L ](S' ](`f'6](S'](S'^̍L gz(N' g(N'6gz(N'gz(N'^̍L ](I' ](6'6](I'](I'^̍L ۿ(\' (\'6ۿ(\'ۿ(\'^̍L (R' (,'6(R'(R'^̍L (\' (\'6(\'(\'^̍L (f' ('6(f'(f'^̍L ۿ(O' (O'6ۿ(O'ۿ(O'^̍LƐ (O' (O'ǐǐɐ6Ő(O'Đ(O'^̍L͐ (J' (7'ΐΐА6̐(J'ː(J'^̍LԐ Q(2}' d(2}'ՐՐא6ӐQ(2}'ҐQ(2}'^̍Lې L((' L('ܐܐސ6ڐL(('ِL(('^̍L G(2}' 4(2}'6G(2}'G(2}'^̍L L(' J( (0026.J(>'-J(>'^̍L6 E(H' 2(H'77965E(H'4E(H'^̍L= J(R' J(x'>>@6<J(R';J(R'^̍LD o(L' I)L'EEG6Co(L'Bo(L'^̍LK y(B' y((LLN6Jy(B'Iy(B'^̍LR (L' (L'SSU6Q(L'P(L'^̍LY y(V' y(|'ZZ\6Xy(V'Wy(V'^̍L` o(' I)'aac6_o('^o('^̍Lg y(' y('hhj6fy('ey('^̍Ln (' ('ooq6m('l('^̍Lu y(ij' y('vvx6ty(ij'sy(ij'^̍L| m(0~' G )0~'}}6{m(0~'zm(0~'^̍L w(&' w('6w(&'w(&'^̍L (0~' (0~'6(0~'(0~'^̍L w(:y' w(`f'6w(:y'w(:y'^̍L i(G' C )G'6i(G'i(G'^̍L s(L' s(n_'6s(L's(L'^̍L }(G' (G'6}(G'}(G'^̍L s(B' s(/'6s(B's(B'^̍L 1(^" (^"61(^"1(^"^̍L ;(T" ;(.#6;(T";(T"^̍L‘ E(^" kx(^"ÑÑő6E(^"E(^"^̍Lɑ ;(h" ;("ʑʑ̑6ȑ;(h"Ǒ;(h"^̍LБ (# (#ёёӑ6ϑ(#Α(#^̍Lב (# (-#ؑؑڑ6֑(#Ց(#^̍Lޑ (# (#ߑߑ6ݑ(#ܑ(#^̍L (# (B"6(#(#^̍L (" ("6("("^̍L (" (x"6("("^̍L (" ("6("("^̍L (" (س"6("("^̍L yq(" S("   6yq("yq("^̍L l(" l(x"6l(" l("^̍L g(" T("6g("g("^̍L l(" l(س" 6l("l("^̍L$ yq(# S(#%%'6#yq(#"yq(#^̍L+ l(# l(-#,,.6*l(#)l(#^̍L2 g(# T(#33561g(#0g(#^̍L9 l(# l(B"::<68l(#7l(#^̍L@ ''S, S, " |n(^N" |n(" S(" S(" *(" (x" (x" (ʂ" N5()g" b($, @W%>$, %+ %%%+ %%%:+ $:+ $+ $+ $P+ȯ $+ \@%G,ȯ N%M, q%M,w & G, c&+9 &k+ i'* (*R A(* wc)T*> ii)F* ii)b)ȯ nc)S) )( 2#)(N e)L( !)n(s ))Y( w)( ~ )R[( )*(W )[( )S, 'S,iBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~’ÒĒŒƒǒȒɒʒ˒̒͒ΒϒВђҒӒԒՒ֒גْؒڒےܒݒޒߒ      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~֍@ ! )  n ) ֍@ &$ "  q " ֍@ 1 %  ~ % ֍@ ? L$  ] L$ ֍@ B &  [ & ֍@ D #  # ֍@ \ (  E ( ֍@ !  ! ֍@ m )  ) ֍@ % Za+  Za+ ֍@ #  \! ֍@ " " " "R9 N" d%-  i% j% a %5 !Ơ% !% !d% !JL#Z F!/#Z !.# !"8 !" !" !") !V"@ !" T!" T!3! ,!Q ! *!Q !S L! ! !D! !G! {d!}!ȯ <^!,! <^!"X r\!" \!" \!b" AT!b" AT!" ^!" ^!;#0 (!$0 ^!&$ ^!Y}% M!p%  !p% !Y}% !" [!" [!d" !d" !"w ! " !! !Pk!w !D! "! ! ! K *!  #! ȯ !  !ȯ *! "f“ÓēœƓǓȓɓʓ˓͓̓ΓϓГѓғӓԓՓ֓דؓٓړۓܓݓޓߓ֍@ =!nO"  R!nO" ֍@ !B!  Z!B! ֍@ !%  e\!% ֍@ I!*  e!* ֍@ g!zU)  !zU) ֍@ W!"  !" ֍@ !Xt&8 ?! &8 !& "& " & I<" & I<"[&t @R"g& >"i&ȯ " e& "%ȯ >"c% q""[% q""#k g'"h#k q""2t# q""#k g'"#  !#k !# !2t#k !h#k !# !Tp%U  !q% /F"% /F"U& &"Xt& \"Xt&     ֍@ !q'  >!q' ֍@ !"  +"" !  "֍@ s! (  k(! ( $##%֍@ a!6r'  G"6r' '&&(֍@ f!vT! f!!? !! !&"ۯ "" ͖"" ͖""X g"#k ]"# ]"2t#k g"h#  "h#k "2t# "#k "#X Q"" Q" "گ "~" SM"w! SM"p! y"p! y"! N"! N"R!N Q"D!h 9"! R"  1! "!i /!D!V*))))))))))))))))))))))))))))))+,-./0123456789:;<=>?@ABCDEFG֍@ s"Zw  P"Zw IHHJ֍@ %5"K# %5"L$ȯ @"ë$ k"$ȯ _"$ "$4 &"$ #$ !#/$ !#>% U">% U"% K#% K#& cz#& cz#% [#% [#o% #h% #$ Q#$ Q#(%  $(% $$ B$$`C N$$ +p$$ +p$"$ )q$"$ )q$G$ $G$ $$ $$ O$pp$  #pp$ #$ #$ #H$ ^#H$ ^#U_$ #c$ #G$ 5"G$ 5"$ "$ "~$ "K#X "h#k "2t# "#k "#  1"#k 6"# 6"2t#k 1"h#XLKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~֍@ 6"|(  m"|( ֍@ yY" +  ݦ" + ֍@ o"'  "' ֍@ v"((  )"(( ֍@ {|"$'  "$' ֍@ }"f%  i"f% ֍@ s"  2# ֍@ }")  #) ֍@ "!  )$#! ֍@ "~'  <#~' ֍@ "h*  A=#h* ֍@ e#(  P#( ֍@ #,"  }e#," ֍@ %/#h&  |#h& ֍@ :#`!  _#`! ֍@ =##  ## ֍@ w#!  1#! ֍@ ##"  ##" ֍@ #!!  w,$!! ֍@ # #  q/$ # ֍@ #c 9$ 9$  K$ K$! K$!! K$S! $S! $>!7 !$!  $! }$! }$S! $S! $!! $! $ $  $< ȯ h$  P$+  C$( dl Ѕ$$. =$c o$A o$  $ $@! $(!! $S! d$S! d$ !, K$!  %! .%5! .%S! %S! %(!! %@! % #$  #$9 ,A X$\4 q{ %.  %  % %@! %(!! %S! %S! %! $!  %N%!J w<%! w<%S! eE%S! eE%(!! eE%@! eE% @%  @%l S%,C: 9%$= $,= m$/q k$?  $YE ܪ$,C: _$$= $,x @$?f <$( v B$  :$XE 0$,  ֯#,”ÔĔŔƔǔȔɔʔ˔͔̔ΔϔДєҔӔԔՔ֔הؔٔڔ۔ܔݔޔߔ   ֍@ $_#  mQ$_#    ֍@ Q$:+ Q$+ ^$+ ^$:+֍@ ?$L!  d$L! ֍@ t#$* Q$* Q$48+ ^$48+ ^$* [$* e$*ߢ $^*  cI$^* I$b* ($F*`s !"֍@ $$)  =r$) $##%֍@ &$H&  is$H& '&&(֍@ O$B'  1$B' *))+֍@ V$+ V$+ v$+ {$+ $X+ $( $p' B%p'- '&Y'- B%B' $B' ޙ$I' #' #D ( #+ȯ #, #,ȯ $#, $#,2 $., N$,^ $+ $+ $+ $:+ t$:+ t$+-,,,,,,,,,,,,,,,,,,,,,,,,,,,./0123456789:;<=>?@ABCDEFG֍@ ҉$* t$* t$48+ $48+ $y* 1$6y*ȯ p$ j* p$S* $4*  g$4* ƴ$S* ƴ$Ja* %$*%IHHHHHHHHHHHHHJKLMNOPQRSTU֍@ 5$)  3%) WVVX֍@ $* $* $48+ %%%48+ %%%* %* %`* G%%-* ;t%*  (%*/) v)%* ]$I*ȯ $(X*ZYYYYYYYYYYYYY[\]^_`abcdef֍@ H%! H%!! H%&T! gO%&T! gO%s! <%!  y%! ;x%! ;x%&T! %&T! %!! %! % {%  {%F 7%` ȯ %bP %e 4%,C: %$= hc%, v% f%  % %%_ %4V "%e "%F  oT% ȯ M%ʾ  M%  H% hggggggggggggggggggggggggggggggggijklmnopqrstuvwxyz{|}~֍@ V%* :%* :%48+ ]%48+ ]%* S%{*ȯ %vl* %+( b%$(Ȑ 7%'  %'?- |%z( '%(ȯ %"( %c*֍@ i%%  %% ֍@ %%:&  %:& ֍@ %(+%  %(+% ֍@ %"  q &" ֍@ %p#  I&p# ֍@ : &" G&$  \&$ 1 K&Oe j`&,   &,֍@ (&  v& ֍@ ,&6% ,&% ,&X% w&X% w&% w&6% w&p]% ,&p]%֍@ /&j$  }&j$ ֍@ 9&$ 9&$ 9&(% }s&(% }s&$ }s&$ }s&$ 9&$•Õĕŕ֍@ D&T]!  a&T]! Ǖƕƕȕ֍@ c&)  &) ʕɕɕ˕֍@ }j& +  & + ͕̕̕Ε֍@ r&+  &+ Еϕϕѕ֍@ ~&#  1&# ӕҕҕԕ֍@ &% &Z% &Z% &W% L'W% L'% 3'% 3'% h'% G'<% 'u% 1'u% 1's% K's% K'7% &7% &p]% &p]% &%֕ՕՕՕՕՕՕՕՕՕՕՕՕՕՕՕՕՕՕՕוٕؕڕەܕݕޕߕ֍@ &  +' ֍@ &$  +'$ ֍@ ! 'l+  m'l+ ֍@ )'&  v'& ֍@ .'!  {'! ֍@ UA',;%  ',;% ֍@ U'U&  'U& ֍@ T|' < %z'&  '&  R'T '  B'֍@ y'+  i8(+ ֍@ '/+  E/(/+   ֍@ '@@%  91(@@%     ֍@ '  8( ֍@ a)+  g)+ 6?''S,>''S,^̍L wT'&' '&'ȯ X'+' '' C(' C(' s''ȯ '' '' '' '' '' '' e'' e'"'6 !"#$%&'6wT'&'wT'&'^̍L+ 'E( ') ') 'TC) A)(TC) A)() C(() C((( L,(( L,(~&) 2(~&) )(>)  _u(>) l(~&) s(~&) s(( 7(( :( ( s( ( s(*( d(*( d({( d(}( az(9(2 .({( (|( (G}( (`) Au(`) Au() () (J) r(J) r()[ (() /(V) ).(V) ).(T) (T) Y'Ȣ) Y')-,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTU6*'E()'E(^̍LY 'v() Vv(*) Z(*) Z(J) (J) () [() [(Ol) () (˺)d c()| Z() Z()[ZZZZZZZZZZZZZ\]^_`abcdefg6X'v()W'v()^̍Lk ڽ(% i(U7% (.%ȯ ( % (~$ #(~$ #( $yr ($ (}$ ? )}$ ? ) D$ ( D$ (.$8 ;(+$ ;(#e= M)#  (#6V (:# (:# (^# (^# (.# r).# r)-# )-# ez)# ez)_$ ) $ȯ )|$ )$ _)$ _)j% )j% )(v%ȯ )% P-)/% )% (h% (%mlllllllllllllllllllllllllllllllllllllllnopqrstuvwxyz{|}~6jڽ(%iڽ(%^̍L M(& f(&ȯ a(`& a((&  a(pG& a(C& (C& (R& (R& (& )& )?B& )M& &(&H M(2&6M(&M(&^̍L ) ( 5) ( 5)' 6N)' g)( g)%( H)(R #)( !)( m$)( m$)S( 6)S(% :)({ +g)[(!> )F( )F( )D(ȯ )16( )%.(6 ) ( ) (^̍LÖ &)(% 8W)% y)}% y)& U)&l +)N%DŖĖĖĖĖĖĖƖǖȖɖʖ6–&)(%&)(%^̍LΖ cf(=" S(="ϖϖі6͖cf(="̖cf(="^̍LՖ k(" k("֖֖ؖ6Ԗk("Ӗk("^̍Lܖ ý(=" (="ݖݖߖ6ۖý(="ږý(="^̍L )(" )("6)(")("^̍L (^" p)^"6(^"(^"^̍L J(" J("6J("J("^̍L %#p$ #p$6%#p$%#p$^̍L Y#[$ Y#H$6Y#[$Y#[$^̍L "o$ 5"o$ 6"o$"o$^̍L "Z$ "G$6 "Z$ "Z$^̍L +(V& (V&6+(V&+(V&^̍L S'V& y'V&6S'V&S'V&^̍L" ?'H& ?'5&##%6!?'H& ?'H&^̍L) A(V& T(V&**,6(A(V&'A(V&^̍L0 -(V& (V&1136/-(V&.-(V&^̍L7 7(H& 7(5&88:667(H&57(H&^̍L> h(V& U(V&??A6=h(V&<h(V&^̍LE or(H& or(5&FFH6Dor(H&Cor(H&^̍LL /(% /(%MMO6K/(%J/(%^̍LS '"# 'v5#TTV6R'"#Q'"#^̍LZ '# פ'#[[]6Y'#X'#^̍La g(#) A)(#)bbd6`g(#)_g(#)^̍Lh { (z0) { (TC)iik6g{ (z0)f{ (z0)^̍Lo (#) '#)ppr6n(#)m(#)^̍Lv m'" '"wwy6um'"tm'"^̍L} 'x" 'e"~~6|'x"{'x"^̍L (X" (k"6(X"(X"^̍L (D" (1"6(D"(D"^̍L ΅'G( ΅'Y(6΅'G(΅'G(^̍L ix'=( e'=(6ix'=(ix'=(^̍L ΅',3( ΅'R (6΅',3(΅',3(^̍L 'ȹ# '#6'ȹ#'ȹ#^̍L I'ܯ# o'ܯ#6I'ܯ#I'ܯ#^̍L '# '#6'#'#^̍L ({) [({)6({)({)^̍L× (ą) ()ėėƗ6—(ą)(ą)^̍Lʗ P(j$ P(}$˗˗͗6ɗP(j$ȗP(j$^̍Lї C(`$ 0(`$җҗԗ6ЗC(`$ϗC(`$^̍Lؗ P(V$ P( D$ٗٗۗ6חP(V$֗P(V$^̍Lߗ '," '#6ޗ',"ݗ',"^̍L '@" z'@"6'@"'@"^̍L T(  A( 6T( T( ^̍L b(  b(л 6b( b( ^̍L b(! b(%!6b(!b(!^̍L T(! A(!6T(!T(!^̍L b( ! b(!   6b( !b( !^̍L T(4! A(4!6T(4!T(4!^̍L b(H! b(n!6b(H!b(H!^̍L W(&  1(& !6W(& W(& ^̍L% c|(O  c|(b &&(6$c|(O #c|(O ^̍L, oS(&  @(& --/6+oS(& *oS(& ^̍L3 c|( c|(.44662c|(1c|(^̍L: Y(} (֊;;=69Y(}8Y(}^̍LA m_(} R(֊BBD6@m_(}?m_(}^̍LH '} ='֊IIK6G'}F'}^̍LO '} '֊PPR6N'}M'}^̍LV '&  '& WWY6U'& T'& ^̍L] 'O  'b ^^`6\'O ['O ^̍Ld '&  %z'& eeg6c'& b'& ^̍Lk ' '.lln6j'i'^̍Lr 'PB' 'PB'ssu6q'PB'p'PB'^̍Ly F'd8' F'%'zz|6xF'd8'wF'd8'^̍L )i( m$)i(6)i(~)i(^̍L ΅'H' ΅'" (6΅'H'΅'H'^̍L ΅'p' ΅''6΅'p'΅'p'^̍L 'wV& 'wV&6'wV&'wV&^̍L 'wV& %'wV&6'wV&'wV&^̍L 'I& '86&6'I&'I&^̍L ;<$} ;<$W6;<$};<$}^̍L $$, $,6$$,$$,^̍L ;<$۷ ;<$6;<$۷;<$۷^̍L $, $,˜6$,$,^̍LƘ $۷ $ǘǘɘ6Ř$۷Ę$۷^̍L͘ Bv%, hc%,ΘΘИ6̘Bv%,˘Bv%,^̍LԘ %۷ %՘՘ט6Ә%۷Ҙ%۷^̍Lۘ M&, j`&,ܘܘޘ6ژM&,٘M&,^̍L &,  &,6&,&,^̍L ?6&۷ ?6&6?6&۷?6&۷^̍L #@% #%6#@%#@%^̍L /"h% U"h%6/"h%/"h%^̍L #Q% #>%6#Q%#Q%^̍L f"! y"!6f"!f"!^̍L BY"! BY"p!  6 BY"! BY"!^̍L BY"! BY"!6BY"!BY"!^̍L %+ %+6%+%+^̍L! %+ 3%+""$6  %+ %+^̍L( %K+ %9+))+6'%K+&%K+^̍L/ o)"& I<"&0026.o)"&-o)"&^̍L6 "0& " &77965"0&4"0&^̍L= "& "&>>@6<"&;"&^̍LD ǽ B" ǽ "EEG6Cǽ B"Bǽ B"^̍LK b V" V"LLN6Jb V"Ib V"^̍LR ǽ j" ǽ "SSU6Qǽ j"Pǽ j"^̍LY !*" [!*"ZZ\6X!*"W!*"^̍L` !" !"aac6_!"^!"^̍Lg !>" !d"hhj6f!>"e!>"^̍Ln O^$o$ )q$o$ooq6mO^$o$lO^$o$^̍Lu *$o$ $o$vvx6t*$o$s*$o$^̍L| D$Z$ D$G$}}6{D$Z$zD$Z$^̍L `&O$ }s&O$6`&O$`&O$^̍L L&O$ 9&O$6L&O$L&O$^̍L V&$ V&$6V&$V&$^̍L `&$ }s&$6`&$`&$^̍L V&N$ V&(%6V&N$V&N$^̍L L&$ 9&$6L&$L&$^̍L Wr'% 1'%6Wr'%Wr'%^̍L ^'% K'%6^'%^'%^̍L kh'% kh's%6kh'%kh'%^̍L™ '!q' !q'ÙÙř6'!q''!q'^̍Lə o!' o!t'ʙʙ̙6șo!'Ǚo!'^̍LЙ Q!q' >!q'љљә6ϙQ!q'ΙQ!q'^̍Lי o!*?' o!P,'ؙؙڙ6֙o!*?'ՙo!*?'^̍Lޙ ?"  R" ߙߙ6ݙ?" ܙ?" ^̍L "  1! 6 "  " ^̍L _&"  _&" 6_&" _&" ^̍L &+ &+6&+&+^̍L ɧ&, ɧ&),6ɧ&,ɧ&,^̍L &+ r&+6&+&+^̍L ɧ&+ ɧ&+   6ɧ&+ɧ&+^̍L %(+ i8(+6%(+ %(+^̍L q(, q(),6q(,q(,^̍L S'+ y'+ 6S'+S'+^̍L$ q(+ q(+%%'6#q(+"q(+^̍L+ }='U, )0'VH,,,.6*}='U,)}='U,^̍L2 m'U, {'VH,33561m'U,0m'U,^̍L9 o&% w&%::<68o&%7o&%^̍L@ W&~% W&X%AAC6?W&~%>W&~%^̍LG ?&% ,&%HHJ6F?&%E?&%^̍LN &% &%OOQ6M&%L&%^̍LU &% &%VVX6T&%S&%^̍L\ &Jp% &p]%]]_6[&Jp%Z&Jp%^̍Lc o&% w&%ddf6bo&%ao&%^̍Lj ?&% ,&%kkm6i?&%h?&%^̍Lq W&Jp% W&p]%rrt6pW&Jp%oW&Jp%^̍Lx )' ) (yy{6w)'v)'^̍L (ҹ' C(ҹ'6~(ҹ'}(ҹ'^̍L ^)2& ^)&6^)2&^)2&^̍L e(`$ ? )`$6e(`$e(`$^̍L (j$ (}$6(j$(j$^̍L (V$ ( D$6(V$(V$^̍L ^ " q "6^ "^ "^̍L J " J d"6J "J "^̍L 7 " &$ "67 "7 "^̍L J ڃ" J q"6J ڃ"J ڃ"^̍L E"" +""6E""E""^̍LŚ m"Ե" m""ƚƚȚ6Ěm"Ե"Úm"Ե"^̍L̚ !" !"͚͚Ϛ6˚!"ʚ!"^̍LӚ m"$" m"J{"ԚԚ֚6Қm"$"њm"$"^̍Lښ Q#! )$#!ۚۚݚ6ٚQ#!ؚQ#!^̍L y"! y"\!6y"!ߚy"!^̍L "! "!6"!"!^̍L y"Է! y"!6y"Է!y"Է!^̍L /'U& 'U&6/'U&/'U&^̍L W|'i& W|'|&6W|'i&W|'i&^̍L h'U& U'U&6h'U&h'U&^̍L W|'$B& W|'J/&  6 W|'$B& W|'$B&^̍L Z'l+ m'l+6Z'l+Z'l+^̍L F'D+ F'+6F'D+F'D+^̍L 2'l+ ! 'l+!!#62'l+2'l+^̍L' F'm+ F'Z+((*6&F'm+%F'm+^̍L. " + ݦ" +//16-" +," +^̍L5 +"+ +"+66864+"+3+"+^̍L< Sl" + yY" +==?6;Sl" +:Sl" +^̍LC +"4}+ +"Zj+DDF6B+"4}+A+"4}+^̍LJ g*#h* A=#h*KKM6Ig*#h*Hg*#h*^̍LQ #@* #*RRT6P#@*O#@*^̍LX #h* "h*YY[6W#h*V#h*^̍L_ #|* #i*``b6^#|*]#|*^̍Lf 3!zU) !zU)ggi6e3!zU)d3!zU)^̍Lm [!Ri) [!,|)nnp6l[!Ri)k[!Ri)^̍Lt z!zU) g!zU)uuw6sz!zU)rz!zU)^̍L{ [!A) [!.)||~6z[!A)y[!A)^̍L `$H& is$H&6`$H&`$H&^̍L L$ & L$&6L$ &L$ &^̍L 8$H& &$H&68$H&8$H&^̍L L$p& L$~&6L$p&L$p&^̍L =#( P#(6=#(=#(^̍L *#( *#Z(6*#(*#(^̍L ?#( e#(6?#(?#(^̍L *#u( *#b(6*#u(*#u(^̍L O"(( )"((6O"((O"((^̍L w"<( w"zO(››ě6w"<(w"<(^̍Lț "(( v"((ɛɛ˛6Ǜ"((ƛ"((^̍Lϛ w"( w"(ЛЛқ6Λw"(͛w"(^̍L֛ R!* e!*ככٛ6՛R!*ԛR!*^̍Lݛ >!ԥ* >!*ޛޛ6ܛ>!ԥ*ۛ>!ԥ*^̍L #+!* I!*6#+!*#+!*^̍L >!$~* >!Jk*6>!$~*>!$~*^̍L Za+ Za+6 Za+ Za+^̍L 2u+ +6 2u+ 2u+^̍L Za+ % Za+6 Za+ Za+^̍L M+ :+ 6 M+ M+^̍L } & [ &6 } & } &^̍L i |& i V&6i |&i |&^̍L U & B &6U &U &^̍L# i ̱& i &$$&6"i ̱&!i ̱&^̍L* %:& %:&++-6)%:&(%:&^̍L1 %|N& %Va&22460%|N&/%|N&^̍L8 %:& %%:&99;67%:&6%:&^̍L? %&& %&@@B6>%&&=%&&^̍LF $ # q/$ #GGI6E$ #D$ #^̍LM $l # $F3#NNP6L$l #K$l #^̍LT # # # #UUW6S# #R# #^̍L[ $" $"\\^6Z$"Y$"^̍Lb #x## ##cce6a#x##`#x##^̍Li Kd## Kd#r#jjl6hKd##gKd##^̍Lp sP## =##qqs6osP##nsP##^̍Lw Kd#v# Kd#d#xxz6vKd#v#uKd#v#^̍L~ ?##" ##"6}?##"|?##"^̍L g#7" g#vJ"6g#7"g#7"^̍L ##" ##"6##"##"^̍L g#" g#!6g#"g#"^̍L l % ~ %6l %l %^̍L 7X % 7X %67X %7X %^̍L _D % 1 %6_D %_D %^̍L 7X ,% 7X R%67X ,%7X ,%^̍L z L$ ] L$6z L$z L$^̍L f $$ f $6f $$f $$^̍LĜ R L$ ? L$ŜŜǜ6ÜR L$œR L$^̍L˜ f t$ f $̜̜Μ6ʜf t$ɜf t$^̍LҜ 3 # #ӜӜ՜6ќ3 #М3 #^̍Lٜ [k # [k #ڜڜܜ6؜[k #ל[k #^̍L W # D #6ߜW #ޜW #^̍L [k @# [k f#6[k @#[k @#^̍L  ! !6 ! !^̍L ? ! ? \!6? !? !^̍L g ! !6g !g !^̍L ? Ҵ! ? !6? Ҵ!? Ҵ!^̍L >$_# mQ$_#   6 >$_#>$_#^̍L *$r# *$#6*$r#*$r#^̍L $_# $_#6$_#$_#^̍L *$(K# *$N8#  "6*$(K#*$(K#^̍L& W#! 1#!'')6%W#!$W#!^̍L- #! #!..06,#!+#!^̍L4 #! w#!55763#!2#!^̍L; #! #6z!<<>6:#!9#!^̍LB k ( E (CCE6Ak (@k (^̍LI |)( V<(JJL6H |)(G |)(^̍LP o ( \ (QQS6Oo (No (^̍LW ( 'XXZ6V (U (^̍L^ i#h& |#h&__a6]i#h&\i#h&^̍Le U#@& U#'ffh6dU#@&cU#@&^̍Ll A#h& %/#h&mmo6kA#h&jA#h&^̍Ls U#& U#&ttv6rU#&qU#&^̍Lz +j&j$ }&j${{}6y+j&j$x+j&j$^̍L SV&}$ SV&$6SV&}$SV&}$^̍L {B&j$ /&j$6{B&j${B&j$^̍L SV&(V$ SV&NC$6SV&(V$SV&(V$^̍L #%(+% %(+%6#%(+%#%(+%^̍L K%?% K%Q%6K%?%K%?%^̍L s%(+% %(+%6s%(+%s%(+%^̍L K%P% K%v%6K%P%K%P%^̍L o&p# I&p#6o&p#o&p#^̍L %H# %"#6%H#%H#^̍L %p# %p#Ý6%p#%p#^̍Lǝ %{# %h#ȝȝʝ6Ɲ%{#ŝ%{#^̍LΝ &T]! a&T]!ϝϝѝ6͝&T]!̝&T]!^̍L՝ k&,q! k&!֝֝؝6ԝk&,q!ӝk&,q!^̍Lܝ W&T]! D&T]!ݝݝߝ6۝W&T]!ڝW&T]!^̍L k&|I! k&6!6k&|I!k&|I!^̍L W&# 1&#6W&#W&#^̍L &# &#6&#&#^̍L &# ~&#6&#&#^̍L &@# &f#6&@#&@#^̍L %" q &" 6%"%"^̍L %t" %N"6 %t" %t"^̍L %" %"6%"%"^̍L %Ĵ" %"6%Ĵ"%Ĵ"^̍L" Q$L! d$L!##%6!Q$L! Q$L!^̍L) =$$" =$!"**,6(=$$"'=$$"^̍L0 *$L! ?$L!1136/*$L!.*$L!^̍L7 =$t! =$!88:66=$t!5=$t!^̍L> $!! w,$!!??A6=$!!<$!!^̍LE $5! $H!FFH6D$5!C$5!^̍LL #!! #!!MMO6K#!!J#!!^̍LS $! $6 TTV6R$!Q$!^̍LZ <"Zw  P"Zw [[]6Y<"Zw X<"Zw ^̍La #)"2  #)" bbd6`#)"2 _#)"2 ^̍Lh K"Zw  s"Zw iik6gK"Zw fK"Zw ^̍Lo #)"c  #)"O ppr6n#)"c m#)"c ^̍Lv {O!$ {O!)$wwy6u{O!$t{O!$^̍L} ;!$ (!$~~6|;!${;!$^̍L {O!8# {O!^#6{O!8#{O!8#^̍L %% %%6%%%%^̍L %x% %R%6%x%%x%^̍L C%% i%%6C%%C%%^̍L %ȵ% %%6%ȵ%%ȵ%^̍L {',;% ',;%6{',;%{',;%^̍L h'O% h'a%6h'O%h'O%^̍L /T',;% UA',;%6/T',;%/T',;%^̍L h'T'% h'z%6h'T'%h'T'%^̍LÞ si(x% si(%ĞĞƞ6žsi(x%si(x%^̍Lʞ U(0d% B(0d%˞˞͞6ɞU(0d%ȞU(0d%^̍Lў si(XP% si(~=%ҞҞԞ6Оsi(XP%Ϟsi(XP%^̍L؞ _(@@% 91(@@%ٞٞ۞6מ_(@@%֞_(@@%^̍Lߞ (T% (f%6ޞ (T%ݞ (T%^̍L '@@% '@@%6'@@%'@@%^̍L (h,% (%6 (h,% (h,%^̍L s)# M)#6s)#s)#^̍L (# (b#6(#(#^̍L (# (#6(#(#^̍L (س# (#   6(س#(س#^̍L (! (!6(!(!^̍L (! (!6(!(!^̍L (D! (j!!6(D!(D!^̍L% (|5! (|5!&&(6$(|5!#(|5!^̍L, (TI! (.\!--/6+(TI!*(TI!^̍L3 (!! (!44662(!!1(!!^̍L: &(  8( ;;=69&( 8&( ^̍LA 9(l  9(F!BBD6@9(l ?9(l ^̍LH a'  ' IIK6Ga' Fa' ^̍LO 9(  9( PPR6N9( M9( ^̍LV (ܨ  q(ܨ WWY6U(ܨ T(ܨ ^̍L] (  ( ^^`6\( [( ^̍Ld (  (* eeg6c( b( ^̍Lk '  +' lln6j ' i ' ^̍Lr 3'Ԧ  3' ssu6q3'Ԧ p3'Ԧ ^̍Ly [&  & zz|6x[& w[& ^̍L 3'$  3'Jl 63'$ ~3'$ ^̍L i'! {'!6i'!i'!^̍L GU'! GU'!6GU'!GU'!^̍L oA'! .'!6oA'!oA'!^̍L GU'm! GU'.Z!6GU'm!GU'm!^̍L )c&  v& 6)c& )c& ^̍L QO&t  QO&N!6QO&t QO&t ^̍L y;&  (& 6y;& y;& ^̍L QO&  QO& 6QO& QO& ^̍L |' 'Ÿ6|'|'^̍LƟ h'h  h'B ǟǟɟ6şh'h ğh'h ^̍L͟ T' B'ΟΟП6̟T'˟T'^̍Lԟ h' h'՟՟ן6ӟh'ҟh'^̍L۟ R#," }e#,"ܟܟޟ6ڟR#,"ٟR#,"^̍L >#" >#ޥ"6>#">#"^̍L *#," #,"6*#,"*#,"^̍L >#Tk" >#zX"6>#Tk">#Tk"^̍L !" !"6!"!"^̍L !," !?"6 !," !,"^̍L 1!" W!"61!"1!"^̍L !8" !^!  6  !8" !8"^̍L u#`! _#`!6u#`!u#`!^̍L a#8" a#"6a#8"a#8"^̍L! M#`! :#`!""$6 M#`!M#`!^̍L( a#! a#!))+6'a#!&a#!^̍L/ ?!nO" R!nO"0026.?!nO"-?!nO"^̍L6 +!Fc" +! v"77965+!Fc"4+!Fc"^̍L= !nO" =!nO">>@6<!nO";!nO"^̍LD +!;" +!("EEG6C+!;"B+!;"^̍LK 3!/# F!/#LLN6J3!/#I3!/#^̍LR !C# !nV#SSU6Q!C#P!C#^̍LY !# ! #ZZ\6X!#W!#^̍L` 3G!B! Z!B!aac6_3G!B!^3G!B!^̍Lg [3!! [3!!hhj6f[3!!e[3!!^̍Ln !B! !B!ooq6m!B!l!B!^̍Lu [3!jr! [3!_!vvx6t[3!jr!s[3!jr!^̍L| I!% e\!%}}6{I!%zI!%^̍L 5!'% 5!:%65!'%5!'%^̍L !!% !%6!!%!!%^̍L 5!D% 5!j$65!D%5!D%^̍L "$' "$'6"$'"$'^̍L -"' -"+'6-"'-"'^̍L U"$' {|"$'6U"$'U"$'^̍L -"L& -"r&6-"L&-"L&^̍L p"|( m"|(6p"|(p"|(^̍L \"T( \".(6\"T(\"T(^̍L  H"|( 6"|(ààŠ6H"|(H"|(^̍Lɠ \"( \"ʮ(ʠʠ̠6Ƞ\"(Ǡ\"(^̍LР ;)#~' <#~'ѠѠӠ6Ϡ;)#~'Π;)#~'^̍Lנ c#' c#Ƥ'ؠؠڠ6֠c#'ՠc#'^̍Lޠ #~' "~'ߠߠ6ݠ#~'ܠ#~'^̍L c# d'&^̍LG 3P'' 3P'v'HHJ6F3P''E3P''^̍LN [<'& )'&OOQ6M[<'&L[<'&^̍LU 3P'& 3P'&VVX6T3P'&S3P'&^̍L\ c_$) =r$)]]_6[c_$)Zc_$)^̍Lc K$) K$)ddf6bK$)aK$)^̍Lj 7$) $$)kkm6i7$)h7$)^̍Lq K$8) K$^)rrt6pK$8)oK$8)^̍Lx ") #)yy{6w")v")^̍L /"ز) /")6~/"ز)}/"ز)^̍L W") }")6W")W")^̍L /"() /"Nx)6/"()/"()^̍L 4"6r' G"6r'64"6r'4"6r'^̍L !"' !"'6!"'!"'^̍L ; "6r' a!6r'6; "6r'; "6r'^̍L !"^^' !"K'6!"^^'!"^^'^̍L \ ) n )6 \ ) \ )^̍L 3H `) 3H :)63H `)3H `)^̍L [4 ) ! )6[4 )[4 )^̍Lš 3H ) 3H ֋)ơơȡ6ġ3H )á3H )^̍L̡ & + & +͡͡ϡ6ˡ& +ʡ& +^̍Lӡ /&+ /&^1+ԡԡ֡6ҡ/&+ѡ/&+^̍Lڡ W}& + }j& +ۡۡݡ6١W}& +ءW}& +^̍L /&* /&*6/&*ߡ/&*^̍L k(/+ E/(/+6k(/+k(/+^̍L (B+ (U+6(B+(B+^̍L '/+ '/+6'/+'/+^̍L ((+ (N+6((+((+^̍L &}+ &$j+6 &}+ &}+^̍L T)+ g)+  6 T)+ T)+^̍L A)`+ A):+6A)`+A)`+^̍L ;-)+ a)+6;-)+;-)+^̍L A)+ A)ֱ+!!#6A)+A)+^̍L' '&) &)((*6&'&)%'&)^̍L. O&) O&b)//16-O&),O&)^̍L5 wv&) c&)66864wv&)3wv&)^̍L< O&إ) O&)==?6;O&إ):O&إ)^̍LC %) 3%)DDF6B %)A %)^̍LJ %) %)KKM6I %)H %)^̍LQ $) 5$)RRT6P$)O$)^̍LX %D) %j)YY[6W %D)V %D)^̍L_ sP(# sP(^$``b6^sP(#]sP(#^̍Lf <(# )(#ggi6e<(#d<(#^̍Lm kN(|! Ea(|!nnp6lkN(|!kkN(|!^̍Lt :(T! :(. "uuw6s:(T!r:(T!^̍L{ &(|! (|!||~6z&(|!y&(|!^̍L :(! :(ʽ!6:(!:(!^̍L ['l" t'l"6['l"['l"^̍L 3'" 3'"63'"3'"^̍L F)X" Y)X"6F)X"F)X"^̍L +)X" Q )X"6+)X"+)X"^̍L 3)" 3)"63)"3)"^̍L wF)]" QY)]"6wF)]"wF)]"^̍L 2)lq" 2)F"62)lq"2)lq"^̍L 2)I" 2)6"62)I"2)I"^̍L 0)% 0)n%¢¢Ģ60)%0)%^̍LȢ )% )%ɢɢˢ6Ǣ)%Ƣ)%^̍LϢ k'Rk( 'Rk(ТТҢ6΢k'Rk(͢k'Rk(^̍L֢ [A'( [A'~(עע٢6բ[A'(Ԣ[A'(^̍Lݢ -'' ''ޢޢ6ܢ-''ۢ-''^̍L ǎ'Dv' {'Dv'6ǎ'Dv'ǎ'Dv'^̍L )y( #)(6)y()y(^̍L )g( #)(6)g()g(^̍L W() }()6W()W()^̍L /() /(ڴ)6/()/()^̍L ;() (() 6;();()^̍L O() O()6 O() O()^̍L )(% e,)(%6)(%)(%^̍L )& )&6)&)&^̍L# )P% )v%$$&6")P%!)P%^̍L* '$ +'$++-6) '$( '$^̍L1 3'$ 3'~ %224603'$/3'$^̍L8 [&$ &$99;67[&$6[&$^̍L? 3'$ 3'$@@B6>3'$=3'$^̍LF w$pp$ O$pp$GGI6Ew$pp$Dw$pp$^̍LM #pp$ #pp$NNP6L#pp$K#pp$^̍LT #\$ #H$UUW6S#\$R#\$^̍L[ ,#gb$ #`T$\\^6Z,#gb$Y,#gb$^̍Lb H#gb$ V#`T$cce6aH#gb$`H#gb$^̍Li "f% i"f%jjl6h"f%g"f%^̍Lp "`z% ":%qqs6o"`z%n"`z%^̍Lw ߏ"f% }"f%xxz6vߏ"f%uߏ"f%^̍L~ "R% "?%6}"R%|"R%^̍L iw$(  C$( 6iw$( iw$( ^̍L c$  c$0 6c$ c$ ^̍L O$(  <$( 6O$( O$( ^̍L $!  $^4 6 $!  $! ^̍L %  % 6% % ^̍L 9%%  9%8 69%% 9%% ^̍L ay%  f% 6ay% ay% ^̍L I&$  \&$ 6I&$ I&$ ^̍L 5&&  5&9 65&& 5&& ^̍Lģ !"&$  G&$ ţţǣ6ã!"&$ £!"&$ ]1^^@+YkÖΖՖܖ ")07>ELSZahov}×ʗїؗߗ %,3:AHOV]dkryƘ͘Ԙۘ !(/6=DKRY`gnu|™əЙיޙ$+29@GNU\cjqxŚ̚Ӛښ  '.5<CJQX_fmt{țϛ֛ݛ#*18?FMT[bipw~Ĝ˜Ҝٜ &-4;BIPW^elszǝΝ՝ܝ ")07>ELSZahov}Þʞў؞ߞ %,3:AHOV]dkryƟ͟ԟ۟ !(/6=DKRY`gnu| ɠРנޠ$+29@GNU\cjqxš̡ӡڡ  '.5<CJQX_fmt{ȢϢ֢ݢ#*18?FMT[bipw~ģʣ ELSZahov}Èʈш؈߈ %,3:AHOV]dkryƉ͉ԉۉ !(/6=DKRY`gnu|ŠɊЊ׊ފ$+29@GNU\cjqxŋ̋Ӌڋ  '.5<CJQX_fmt{Ȍό֌݌#*18?FMT[bipw~čˍҍٍ &-4;BIPW^elszǎΎՎ܎ ")07>ELSZahov}Ïʏя؏ߏ %,3:AHOV]dkryƐ͐Ԑې !(/6=DKRY`gnu|‘ɑБבޑ$+29أ $<, )$<, )zEzLzSzZzazhzozvz}zzzzzzzzzzzzzzzzzzz{ {{{{%{,{3{:{A{H{O{V{]{d{k{r{y{{{{{{{{{{{{{{{{{{{{| |||!|(|/|6|=|D|K|R|Y|`|g|n|u|||||||||||||||||||||}}}}}$}+}2}9}@}G}N}U}\}c}j}q}x}}}}}}}}}}}}}}}}}}}}~ ~~~ ~'~.~5~<~C~J~Q~X~_~f~m~t~{~~~~~~~~~~~~~~~~~~~#*18?FMT[bipw~ &-4;BIPW^elszǀ΀Հ܀ ")07>ELSZahov}Áʁс؁߁ %,3:AHOV]dkry CBoardArrayCBoard `b Py6b Py6 , ` ,JL 4) *TL S* ^S*TL 1|c* 1s*TL [* [*TL v&+ &+TL \<* &Q<*TDAGeGrG~GGGGGGGGGGGGGGGGGGHHHHH$H+H2H9H@HGHNHUH\HcHjHqHxHHHHHHHHHHHHHHHHHHHHI III I'I.I5ILELLLSLZLaLhLoLvL}LLLLLLLLLLLLLLLLLLLM MMMM%M,M3M:MAMHMOMVM]MdMkMrMyMMMMMMMMMMMMMMMMMMMQOXO_OfOmOtO{OOOOOOOOOOOOOOOOOOOPPPPP#P*P1P8P?PFPMPTP[PbPiPpPwP~PPPPPPPPPPPPPPPPPPPQ QQQQ&Q-Q4Q;QBQIQPQWQ^QeQlQsQzQQQQQQQQQQQQQQQQQQQQR RRR"R)R0R7R>RERLRSRZRaRhRoRvR}RRRRRRRRRRRRRRRRRRRS SSSS%S,S3S:SASHSOSVS]SdSkSrSySSSSSSSSSSSSSSSSSSSST TTT!T(T/T6T=TDTKTRTYT`TgTnTuT|TTTTTTTTTTTTTTTTTTTUUUUU$U+U2U9U@UGUNUUU\UcUjUqUxUUUUUUUUUUUUUUUUUUUUV VVV V'V.V5Vs?@@@@@@@@A AAA!A(A/A6A=ADAKARAYA`AgAnAuA|AAAAAAAAAAAAAAAAAAABBBBB^E^L^S^Z^a^h^o^v^L R, <R, <$TL , J, J\  TL D*, nD*, nD*   TL ^+, +, +jTrr|uuuuuuuuuuuuuuuuuuuvvvvv$v+v2v9v@vGvNvUv\vcvjvqvxvvvvvvvvvvvvvvvvvvvvw www w'w.w5wzEzLzSzZzazhzozvz}zzzzzzzzzzzzzzzzzzz{ {{{{%{,{3{:{A{H{O{V{]{d{k{r{y{{{{{{{{{{{{{{{{{{{{| |||!|(|/|6|=|D|K|R|Y|`|g|n|u|||||||||||||||||||||}}}}}$}+}2}9}@}G}N}U}\}c}j}q}x}}}}}}}}}}}}}}}}}}}}~ ~~~ ~'~.~5~<~C~J~Q~X~_~f~m~t~{~~~~~~~~~~~~~~~~~~~#*18?FMT[bipw~ &-4;BIPW^elszǀ΀Հ܀ ")07>ELSZahov}Áʁс؁߁ %,3:AHOV]dkryhjjjjjk kkkk&k-k4k;kBkIkPkWk^keklkskzkkkkkkkkkkkkkkkkkkkkl lll"l)lń̄ӄڄ  '.5<CJQX_fmt{ȅυօ݅#*18?FMT[bipw~Ćˆ҆ن &-4;BIPW^elszLJ·Շ܇ ")07>ELSZahov}Èʈш؈߈ %,3:AHOV]dkryƉ͉ԉۉ !(/6=DKRY`gnu|ŠɊЊ׊ފ$+29@GNU\cjqxŋ̋Ӌڋ  '.5<CJQX_fmt{Ȍό֌݌#*18?FMT[bipw~čˍҍٍ &-4;BIPW^elszǎΎՎ܎ ")07>ELSZahov}Ïʏя؏ߏ %,3:AHOV]dkryƐ͐Ԑې !(/6=DKRY`gnu|‘ɑБבޑ$+29@+YkÖΖՖܖ ")07>ELSZahov}×ʗїؗߗ %,3:AHOV]dkryƘ͘Ԙۘ !(/6=DKRY`gnu|™əЙיޙ$+29@GNU\cjqxŚ̚Ӛښ  '.5<CJQX_fmt{țϛ֛ݛ#*18?FMT[bipw~Ĝ˜Ҝٜ &-4;BIPW^elszǝΝ՝ܝ ")07>ELSZahov}Þʞў؞ߞ %,3:AHOV]dkryƟ͟ԟ۟ !(/6=DKRY`gnu| ɠРנޠ$+29@GNU\cjqxš̡ӡڡ  '.5<CJQX_fmt{ȢϢ֢ݢ#*18?FMT[bipw~ģ$+29@GNU\cjqx  '.5<CJQX_fmt{#*18?FMT[bipw~ &-4;BIPW^elsz ")07>ELSZahov} %,3:AHOV]dkry !(/6=DKRY`gnu|$+29@GNU\cj :AHOV]dkry !(/6=DKq#*18?FMT[bipw~ &-4;BIPW^elsz ")07>ELSZahov}    % , 3 : A H O V ] d k r y ! !!!!!(!/!6!=!D!K!R!Y!`!g!n!u!|!!!!!!!!!!!!!!!!!!!"""""$"+"2"9"@"G"N"U"\"c"j"q"x""""""""""""""""""""# ### #'#.#5#<#C#J#Q#X#_#f#m#t#{###################$$$$$#$*$1$8$?$F$M$T$[$b$i$p$w$~$$$$$$$$$$$$$A(R(Y(`(g(n(u(|((((((((((((((((((()))))$)+)2)9)@)G)N)U)\)c)j)q)x))))))))))))))))))))* *** *'*.*5*<*C*J*Q*X*_*f*m*t*{*******************+++++#+*+1+8+?+F+M+T+[+b+i+p+w+~+++++++++++++++++++, ,,,,&,-,4,;,B,I,P,W,^,e,l,s,z,,,,,,,,,,,,,,,,,,,,- ---"-)-0-7->-E-L-S-Z-a-h-o-v-}-------------------. ....%.,.3.:.A.H.O.V.].d.k.r.y..................../ ///!/(///6/=/D/K/R/Y/`/g/n/u/|///////////////////00000$0+02090@0G0N0U0\0c0j0q0x000000000000000000001 111 1'1.151<1C1J1Q1X1CLayerTypeListUWire Solder Mask{ Paste Mask CLayerArray\TTop Solder Mask@@@@@@@@@Top Paste Mask5Bottom SilkscreenUBottom Solder MaskDocumentation2CLayerSpanArrayCNetClassArray]1Jd5 CSymbolArray I x @ 5SeQ41l6K8:6>w`f4_xl CNetArraytGNDG)]1VDDVCC1GNE-G-]11VDE0G0F- 51GNF3G3]11VDF6G6P12_39G9JP12_4<G<JP11_1?G?JP11_8BGBJP11_9EGEJP11_10HGHJP11_11KGKJ1VSUPPLZNGN1USB_5WQGQ1VBATUTGTP12_5WGWJ P1_RESETOZGZ1GNG]G]]11VDGVDEaGaGNEdGd]11GNHgGg]11VDHjGjP12_6mGmJP12_7pGpJP11_2sGsJP11_12vGvJP11_13yGyJP11_14|G|JP11_15GJ1VSUPPMAG1USB_5XG1VBATVGP12_8GJ P1_RESETPGVCDGG2_GNDG]1VCEGG2_GNEG]1VCFGG2_GNFG]1LRVDDGLRGNDG]1zQ` | ^~61< % q  dRHw1{1#76y73c3^2221%445544 5 6L:898898;88:g;77 7c77$<3Q3+8>"222L29x9:;>;`^8lmld/g_mme^eyeSea`GcbTbbabaaaabcb+b`Nnn>ZStyle1_3,L32s^D`I_plCFreeTextArray CFreeTextX12J L*aNormal1TP19DI"TDC POWER "TLED DISP.+TUSB I/O]*TRF I/Od+TPROGRAMX$#TBATTN'_TPOWERe'_TUSB'_T MSD 112073"TREV 4 !TGNDnZ#TCTextStyleArraya[Errors]1bdk CSpacings     1CComponentArray!x % { X<e g , !e=O1341\645-5 278:6.23>?rCY`gPf^Rg^bbNcTale~ffg^hlCComponentInstanceArray% w  z W;_ f + d7<N_ly$ W  1-44565V655p5544'5R:l999,98>9898<1888:8:m;C;;;;67*<(233W3k31.>J=<<=<<<=>'?3=e===?2R222=h>>lCS`gOfhbhyhdcQg?Cs`gaf^cg^cb_cm fffg2_vl1 COverlayArray .:A 8c @?@@\?i$%#     >=29287 :;65 ?<432E@FDC-P8c1Height 8c 8c 100OFFrmt7715@rit.edu smoortser1GreenWhiteLPIFR4Lead Free SolderNone1 oz1 ozWOCCSRev_11 Week Prototype1.3.3=$'